Bcl-xL siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemBcl-xL siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-43630
Gene NameBCL2-like 1
Quantity10 µM
Specieshuman
NCBI Full Gene NameBCL2 like 1
NCBI Gene AliasesBCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) BCL(X)L and BCL2 increase the metabolic fitness of breast cancer cells: a single-cell imaging studyCell death and differentiationMay 1, 2021Lucantoni F, Salvucci M, Düssmann H, Lindner AU, Lambrechts D, Prehn JHM.siRNA targeting BCL2 (Santa Cruz 605 Biotechnology, sc-61899) or BCL(X)L (Santa Cruz Biotechnology, sc-43630) was 606 transfected employing Lipofectamine. MCF7-pSFFV and MDA-231 cells were seeded at a 607 density

(2) Mcl-1 targeting strategies unlock the proapoptotic potential of TRAIL in melanoma cellsMolecular carcinogenesisNovember 1, 2020Sarif Z, Tolksdorf B, Fechner H, Eberle J.

(3) Regorafenib Alteration of the BCL-xL/MCL-1 Ratio Provides a Therapeutic Opportunity for BH3-Mimetics in Hepatocellular Carcinoma ModelsCancersFebruary 1, 2020Cucarull B, Tutusaus A, Subías M, Stefanovic M, Hernáez-Alsina T, Boix L, Reig M, García de Frutos P, Marí M, Colell A, et al.Pierce (Thermo Fisher Scientific, Rockford, IL, USA). BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), while a second

(4) Upregulated cyclin B1/CDK1 mediates apoptosis following 2-methoxyestradiol-induced mitotic catastrophe: Role of Bcl-X(L) phosphorylationSteroidsOctober 1, 2019Choi HJ, Zhu BT.

(5) Mitochondrial superoxide dismutase 2 mediates γ-irradiation-induced cancer cell invasionExperimental & molecular medicineFebruary 12, 2019Jung CH, Kim EM, Song JY, Park JK, Um HD.

(6) Abnormal expression of miR‑133a in patients with acute myocardial infarction following radical surgery for gastric cancer and the underlying mechanismMolecular medicine reportsDecember 1, 2018Yu J, Cao X, Zheng Y, Yan L, Wang J.5′ACGUGACACGUUCGGAGAATT3′; 50 nM) or 2 µl B-cell lymphoma 2 (Bcl-2)-like 1 (Bcl2l1) small interfering (si)RNA (cat. no. sc-43630; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were transfected into HUVECs (5×104 cells/well) using

(7) Antiapoptotic BCL-2 proteins determine sorafenib/regorafenib resistance and BH3-mimetic efficacy in hepatocellular carcinomaOncotargetMarch 30, 2018Tutusaus A, Stefanovic M, Boix L, Cucarull B, Zamora A, Blasco L, de Frutos PG, Reig M, Fernandez-Checa JC, Marí M, et al.from Pierce (Thermo Fisher Scientific, Rockford, IL). BCL-2 siRNA (h) (sc-29214), BCL-xL siRNA (h) (sc-43630), MCL-1 siRNA (h) (sc-35877) and scrambled controls were purchased from Santa Cruz Biotechnology (Dallas,

(8) STAT3 and NF-κB cooperatively control in vitro spontaneous apoptosis and poor chemo-responsiveness in patients with chronic lymphocytic leukemiaOncotargetMay 31, 2016Liu FT, Jia L, Wang P, Wang H, Farren TW, Agrawal SG.

(9) S6K1 inhibition enhances the apoptotic cell death of breast cancer cells in response to Bcl-2/Bcl-xL inhibition by the downregulation of survivinOncology lettersAugust 1, 2015Park JA, Jin HO, Lee HN, Kim JH, Park IC, Noh WC, Chang YH, Hong YJ, Kim KC, Lee JK.Pierce, Rockford, IL, USA). small interfering (siRNA) and transfection. Bcl‑2 (cat no. sc‑29214), Bcl‑xL (cat no. sc‑43630) and control (cat no. sc‑37007) siRNAs were purchased from Santa Cruz Biotechnology, Inc. (San Jose,

(10) Mechanism of synergy of BH3 mimetics and paclitaxel in chronic myeloid leukemia cells: Mcl-1 inhibitionEuropean journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical SciencesApril 5, 2015Song T, Chai G, Liu Y, Xie M, Chen Q, Yu X, Sheng H, Zhang Z.

(11) MCL-1, BCL-XL and MITF Are Diversely Employed in Adaptive Response of Melanoma Cells to Changes in MicroenvironmentPloS oneJanuary 1, 2015Hartman ML, Talar B, Gajos-Michniewicz A, Czyz M.

(12) PI3K/Akt regulates survival during differentiation of human macrophages by maintaining NF-κB-dependent expression of antiapoptotic Bcl-xLJournal of leukocyte biologyDecember 1, 2014Busca A, Saxena M, Iqbal S, Angel J, Kumar A.

(13) Histone deacetylase inhibitor sensitizes apoptosis-resistant melanomas to cytotoxic human T lymphocytes through regulation of TRAIL/DR5 pathwayJournal of immunology (Baltimore, Md. : 1950)April 15, 2014Jazirehi AR, Kurdistani SK, Economou JS.

(14) Role of cyclin B1/Cdc2 in mediating Bcl-XL phosphorylation and apoptotic cell death following nocodazole-induced mitotic arrestMolecular carcinogenesisFebruary 1, 2014Choi HJ, Zhu BT.

(15) Gamma-secretase inhibition attenuates oxaliplatin-induced apoptosis through increased Mcl-1 and/or Bcl-xL in human colon cancer cellsApoptosis : an international journal on programmed cell deathOctober 1, 2013Timme CR, Gruidl M, Yeatman TJ.

(16) Anti-apoptotic proteins and catalase-dependent apoptosis resistance in nickel chloride-transformed human lung epithelial cellsInternational journal of oncologySeptember 1, 2013Yang YX, Li XL, Wang L, Han SY, Zhang YR, Pratheeshkumar P, Wang X, Lu J, Yin YQ, Sun LJ, et al.followed manufacturer’s recommended protocol. Small interference RNA (siRNA) for Bcl-2 (sc-29214), Bcl-xL (sc-43630) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Scrambled control and siRNA for catalase

(17) Critical role for antiapoptotic Bcl-xL and Mcl-1 in human macrophage survival and cellular IAP1/2 (cIAP1/2) in resistance to HIV-Vpr-induced apoptosisThe Journal of biological chemistryApril 27, 2012Busca A, Saxena M, Kumar A.

(18) Extracellular recombinant annexin II confers UVC-radiation resistance and increases the Bcl-xL to Bax protein ratios in human UVC-radiation-sensitive cellsRadiation researchDecember 1, 2011Kita K, Sugita K, Chen SP, Suzuki T, Sugaya S, Tanaka T, Jin YH, Satoh T, Tong XB, Suzuki N.

(19) Bcl-xL is a dominant antiapoptotic protein that inhibits homoharringtonine-induced apoptosis in leukemia cellsMolecular pharmacologyJune 1, 2011Yin S, Wang R, Zhou F, Zhang H, Jing Y.

(20) TNFα cooperates with IFN-γ to repress Bcl-xL expression to sensitize metastatic colon carcinoma cells to TRAIL-mediated apoptosisPloS oneJanuary 17, 2011Liu F, Hu X, Zimmerman M, Waller JL, Wu P, Hayes-Jordan A, Lev D, Liu K.silencing Scramble siRNA (UAGCGACUAAACACAUCAAUU) was obtained from Dharmacon Inc. Bcl-xL-specific siRNA (Cat # sc-43630) and Survivin-specific siRNA (Cat# sc-29499) were obtained from Santa Cruz Biotech. Tumor cells were

Be the First to Write a Review!

Bcl-xL siRNA (h)

Bcl-xL siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (23)

Reviews

Bcl-xL siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map