Smad2/3 shRNA Plasmid (m) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemSmad2/3 shRNA Plasmid (m)
CompanySanta Cruz Biotechnology, Inc.
Price $592.00Supplier Page View Company Product Page
Catalog Numbersc-37239-SH
Quantity20 µg
RNA TypeshRNA Clones
Vector Type (Standardized)Lentiviral
TypeshRNA Plasmid
Speciesmouse
NCBI Full Gene NameSMAD family member 3, SMAD family member 2
NCBI Gene Aliases7120426M23Rik, Madr2, Smad-2, Madh2, Madh3, mMad2

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) TGF-β promotes pericyte-myofibroblast transition in subretinal fibrosis through the Smad2/3 and Akt/mTOR pathwaysExperimental & molecular medicineMay 1, 2022Zhao Z, Zhang Y, Zhang C, Zhang J, Luo X, Qiu Q, Luo D, Zhang J.

(2) Transforming growth factor beta-1 upregulates glucose transporter 1 and glycolysis through canonical and noncanonical pathways in hepatic stellate cellsWorld journal of gastroenterologyOctober 28, 2021Zhou MY, Cheng ML, Huang T, Hu RH, Zou GL, Li H, Zhang BF, Zhu JJ, Liu YM, Liu Y, et al.

(3) Connective Tissue Growth Factor From Periosteal Tartrate Acid Phosphatase-Positive Monocytes Direct Skeletal Stem Cell Renewal and Fate During Bone HealingFrontiers in cell and developmental biologyJanuary 1, 2021Bai Y, Yu T, Deng J, Yang Y, Tan J, Dai Q, Zhang Z, Dong S, Xu J.

(4) Folic acid rescues corticosteroid-induced vertebral malformations in chick embryos through targeting TGF-β signalingJournal of cellular physiologyNovember 1, 2020Cai H, Lin L, Wang G, Berman Z, Yang X, Cheng X.

(5) Transforming growth factor beta induces fibroblasts to express and release the immunomodulatory protein PD-L1 into extracellular vesiclesFASEB journal : official publication of the Federation of American Societies for Experimental BiologyFebruary 1, 2020Kang JH, Jung MY, Choudhury M, Leof EB.

(6) B7-1 drives TGF-β stimulated pancreatic carcinoma cell migration and expression of EMT target genesPloS oneJanuary 1, 2019Kang JH, Jung MY, Leof EB.

(7) Fatty acid synthase is required for profibrotic TGF-β signalingFASEB journal : official publication of the Federation of American Societies for Experimental BiologyJuly 1, 2018Jung MY, Kang JH, Hernandez DM, Yin X, Andrianifahanana M, Wang Y, Gonzalez-Guerrico A, Limper AH, Lupu R, Leof EB.

(8) TGF-β3 Promotes MUC5AC Hyper-Expression by Modulating Autophagy Pathway in Airway EpitheliumEBioMedicineJuly 1, 2018Zhang Y, Tang H, Yuan X, Ran Q, Wang X, Song Q, Zhang L, Qiu Y, Wang X.

(9) SOX9 protein is stabilized by TGF-β and regulates PAPSS2 mRNA expression in chondrocytesOsteoarthritis and cartilageFebruary 1, 2017Chavez RD, Coricor G, Perez J, Seo HS, Serra R.

(10) TGF-β regulates phosphorylation and stabilization of Sox9 protein in chondrocytes through p38 and Smad dependent mechanismsScientific reportsDecember 8, 2016Coricor G, Serra R.

(11) Puerarin Attenuates Cardiac Hypertrophy Partly Through Increasing Mir-15b/195 Expression and Suppressing Non-Canonical Transforming Growth Factor Beta (Tgfβ) Signal PathwayMedical science monitor : international medical journal of experimental and clinical researchMay 5, 2016Zhang X, Liu Y, Han Q.

(12) p-SMAD2/3 and DICER promote pre-miR-21 processing during pressure overload-associated myocardial remodelingBiochimica et biophysica actaJuly 1, 2015García R, Nistal JF, Merino D, Price NL, Fernández-Hernando C, Beaumont J, González A, Hurlé MA, Villar AV.

(13) Gremlin aggravates hyperglycemia-induced podocyte injury by a TGFβ/smad dependent signaling pathwayJournal of cellular biochemistrySeptember 1, 2013Li G, Li Y, Liu S, Shi Y, Chi Y, Liu G, Shan T.

(14) Transforming growth factor type beta 1 increases the expression of angiotensin II receptor type 2 by a SMAD- and p38 MAPK-dependent mechanism in skeletal muscleBioFactors (Oxford, England)July 1, 2013Painemal P, Acuña MJ, Riquelme C, Brandan E, Cabello-Verrugio C.

(15) BAMBI (BMP and activin membrane-bound inhibitor) protects the murine heart from pressure-overload biomechanical stress by restraining TGF-β signalingBiochimica et biophysica actaFebruary 1, 2013Villar AV, García R, Llano M, Cobo M, Merino D, Lantero A, Tramullas M, Hurlé JM, Hurlé MA, Nistal JF.

(16) Activation of MAPK/PI3K/SMAD pathways by TGF-β(1) controls differentiation of radial glia into astrocytes in vitroDevelopmental neuroscienceJanuary 1, 2012Stipursky J, Francis D, Gomes FC.016769 mouse SMAD3 sequence: GATCCGGAAGCTGAGAGTTATAGATTCAAGAGATCTATAACTCTCAGCTTCCTTTTT). Plasmid A (sc-37239-SH, sc-108060; Santa Cruz Biotechnology), which encodes a scrambled shRNA sequence that will not lead to

(17) Smad2/3 is involved in growth inhibition of mouse embryonic palate mesenchymal cells induced by all-trans retinoic acidBirth defects research. Part A, Clinical and molecular teratologySeptember 1, 2009Wang M, Huang H, Chen Y.

(18) Transforming growth factor-beta (TGF-beta) and TGF-beta-associated kinase 1 are required for R-Ras-mediated transformation of mammary epithelial cellsCancer researchAugust 1, 2008Erdogan M, Pozzi A, Bhowmick N, Moses HL, Zent R.

Be the First to Write a Review!