hnRNP A1 siRNA (h2) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemhnRNP A1 siRNA (h2)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-270345
Quantity10 µM
Gene Nameheterogeneous nuclear ribonucleoprotein A1
Specieshuman
NCBI Full Gene Nameheterogeneous nuclear ribonucleoprotein A1
NCBI Gene AliasesHdp, hnRNP A1, ALS20, hnrnp-A1, hnRNP-A1, UP 1, HNRPA1, HNRPA1L3, HDP-1, IBMPFD3, Hnrpa1, ALS19
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Inhibition of heterogeneous nuclear ribonucleoproteins A1 and oxidative stress reduces glycolysis via pyruvate kinase M2 in chronic thromboembolic pulmonary hypertensionJournal of Translational Internal MedicineOctober 1, 2024Lianhua Liu, Wenyi Pang, Jixiang Liu, Shiqing Xu, Zhu Zhang, Risheng Hao, Jun Wan, Wanmu Xie, Xincao Tao, Peiran Yang, et al.AAUCGUCCUCACCAAGUCUGGCAGG; anti-sense strand: CCUGCCAGACUUGGUGAGGACGAUU, Hanheng biology), hnRNPA1 siRNA (Santa Cruz, Cat#: sc-270345) or control siRNA (sense strand: UUCUCCGAACGUGUCACGUTT, anti-sense strand: ACGUGACACGUUCGGAGAATT, Hanheng

(2) Endothelial cell-specific expression of serine/threonine kinase 11 modulates dendritic cell differentiationNature communicationsFebruary 3, 2022Zhao Q, Han YM, Song P, Liu Z, Yuan Z, Zou MH.(Thermo Fisher Scientific). siRNA transfection siRNAs targeting Ptbp1 (sc-38280), Sfpq (sc-38304), Hnrnpa1 (sc-270345), Hur (sc-35619), Lkb1 (sc-35816), and control siRNA (sc-37007) were obtained from Santa Cruz Biotechnology.

(3) hnRNP-A1 binds to the IRES of MELOE-1 antigen to promote MELOE-1 translation in stressed melanoma cellsMolecular oncologyFebruary 1, 2022Charpentier M, Dupré E, Fortun A, Briand F, Maillasson M, Com E, Pineau C, Labarrière N, Rabu C, Lang F.Silencing of hnRNP‐A1 was performed by cotransfecting 50–100 nm of hnRNP‐A1‐specific siRNA (100 nm of sc‐270345, Santa‐Cruz Biotechnology (Heidelberg, Germany) or 50 nm of Hs‐HNRPA1‐1, functionally validated FlexiTube

(4) Potent antiproliferative effect of fatty-acid derivative AIC-47 on leukemic mice harboring BCR-ABL mutationCancer scienceFebruary 1, 2019Shinohara H, Sugito N, Kuranaga Y, Heishima K, Minami Y, Naoe T, Akao Y.with siRNA for PTBP1 (siR‐PTBP1; 5′‐ AUCUCUGGUCUGCUAAGGUCACUUC‐3′; Invitrogen), hnRNPA1 (siR‐hnRNPA1; sc‐270345; Santa Cruz Biotechnology, Santa Cruz, CA, USA) or SRSF3 (siR‐SRSF3; 5′‐UUACACGGCAGCCACAUAGUGUUCU‐3′;

(5) Fyn/heterogeneous nuclear ribonucleoprotein E1 signaling regulates pancreatic cancer metastasis by affecting the alternative splicing of integrin β1International journal of oncologyJuly 1, 2017Jiang P, Li Z, Tian F, Li X, Yang J.I. Small interfering RNA (siRNA) transfection Target-specific siRNAs for hnRNP E1 (sc-43843), hnRNP A1 (sc-270345), SF2/ASF (sc-38319) and SRp20 (sc-38338) were purchased from Santa Cruz Biotechnology and transfected

Be the First to Write a Review!

hnRNP A1 siRNA (h2)

hnRNP A1 siRNA (h2) from Santa Cruz Biotechnology, Inc.

Santa Cruz Biotechnology, Inc.

Citations (5)

Reviews

hnRNP A1 siRNA (h2) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map