Validated SuperSilencing shRNA plasmid expression vector (pGPU6) from GenePharma

Suzhou GenePharma Co., Ltd.

199 Dongping Street

Suzhou Industrial Park, Suzhou 215125

China

Phone: +86-512-86668828
Fax: +86-512-86665900

Email: bd@genepharma.com

(1) Long noncoding RNA X‐inactive specific transcript (lncRNA XIST) inhibits hepatic insulin resistance by competitively binding microRNA‐182‐5pImmunity, Inflammation and DiseaseNovember 7, 2023Guoqing Zhong, Qingping Yang, Yihua Wang, Yuan Liang, Xiaojing Wang, Dongli Zhaointo the pCMV6 vector (PS100001; OriGene) to obtain pCMV6‐XIST vector. XIST short hairpin RNA (shXIST, C02001, cagaagaatggtacaaatccaag) and shRNA negative control (shNC, C03002) were purchased from GenePharma.

(2) Oncogenic microRNA-181d binding to OGT contributes to resistance of ovarian cancer cells to cisplatinCell Death DiscoveryDecember 8, 2021Wei Huang, Ling Chen, Kean Zhu, Donglian Wangfrom Shanghai GenePharma Co., Ltd. (Shanghai, China). The abovementioned silencing plasmids pGPU6 (C02001) were procured from GenePharma (Shanghai, China), while the overexpression plasmids pcDNA3.1 (V79520)

(3) RETRACTED ARTICLE: CircLNPEP promotes the progression of ovarian cancer through regulating miR-876-3p/ WNT5A axisCell CycleOctober 2, 2021Wenwen Wang, Weiwei Zhang, Hongjun Guo, Danxia Chu, Ruitao Zhang, Ruixia Guo(V87020, ThermoFisher, USA), while sh-circLNPEP or sh-WNT5A was inserted into pGPU6 vector (Genepharma, C02001, China). The empty vector was used as control. Cells (4 × 104 per well) were cultured to 80% confluence

Description