microRNA inhibitors from GenePharma

Product Specs
ItemmicroRNA inhibitors
CompanyGenePharma
Price $89.00Supplier Page View Company Product Page
Catalog NumberB03001
Quantity2 OD
PurityHPLC>95%
TypesiRNA
RNA TypemiRNA Inhibitors

Add to Compare List

GenePharma

Suzhou GenePharma Co., Ltd.

199 Dongping Street

Suzhou Industrial Park, Suzhou 215125

China

Phone: +86-512-86668828
Fax: +86-512-86665900

Email: bd@genepharma.com

Company Profile

Website: http://www.genepharma.com

(1) MYO19 is associated with tumor progression, immune evasion, ferroptosis-related signatures in lung squamous cell carcinomaFrontiers in OncologyJanuary 6, 2026Fang Zhao, Guiying Chen, Jianfeng Pan, Yongxiang Zhang, Wei Li, Kaifeng Niu, Hui Mamanufacturer’s protocol. The sequences targeting to hsa-mir-520a-3p were as follows: hsa-mir-520a-3p inhibitor (B03001, GenePharma, China): 5′‐ACAGUCCAAAGGGAAGCACUUU‐3′. hsa-mir-520a-3p mimics (B02001, GenePharma, China):

(2) Adipose-derived MSC extracellular vesicles ameliorate sepsis by reprogramming macrophages via miR-21-5p targeting PELI1Biomolecules and BiomedicineOctober 27, 2025Guannan Zhou, Jieqiong Song, Lizhen Xuan, Zhunyong Gu, Yimei Liu, Cheng Xu, Hongyu HeWT or pmirGLO-PELI1 Mut constructs. MiR-21-5p mimic (B02003), mimic control (MC, B04002), inhibitor (B03001), and inhibitor control (B04003) were synthesized by Genepharma (Shanghai, China). After 48 h of transfection,

(3) LINC00917 Promotes Bone Metastasis of Breast Cancer by Targeting the miR-491-5p/FOXP4 AxisBreast Cancer (Dove Med Press)October 17, 2025Xin Qu, Cao Wang, Ying Xu, Xin Yang, An-Bing Sun, Xiao-Yu Liu, Jin-Ze Li, Jian-Yun Nie(si-LINC00917, G04009), siRNA negative control (si-NC, A06001), miR-491-5p mimic (B02003), miR-491-5p inhibitor (B03001), and mimic/inhibitor NC (B04002), were procured from GenePharma and their sequences are listed in Supplementary

(4) Plasma-Derived Exosomal i-tRF-LeuCAA as Biomarker for Glioma Diagnosis and Promoter of Epithelial-Mesenchymal Transition via TPM4 RegulationCNS Neurosci TherApril 9, 2025Hongyu Liu, Wentao Hu, Lijun Zhang, Ze Li, Jialin Liu, Ling ChenThe cell lines were reverse transfected with an i‐tRF‐LeuCAA mimic (B02003), i‐tRF‐LeuCAA inhibitor (B03001), negative control (NC) mimic (B04002) or inhibitor (B04003), small interfering RNA (siRNA) for TPM4

(5) Delivering miR-23b-3p by small extracellular vesicles to promote cell senescence and aberrant lipid metabolismBMC BiolFebruary 11, 2025Ye Jin, Gaoge Sun, Binxian Chen, Siqin Feng, Muyun Tang, Hui Wang, Ying Zhang, Yuan Wang, Yang An, Yu Xiao, et al.(GMR-miRTM microRNA double-stranded mimics, B02003), miRNA inhibitors (GMR-miRTM microRNA inhibitors, B03001), or miRNA controls (GMR-miRTM microRNA control, B04003 for single-stranded inhibitor control; B04002

(6) Knockdown of Gfi1 increases BMSCs exosomal miR-150-3p to inhibit osteoblast ferroptosis in steroid-induced osteonecrosis of the femoral head through BTRC/Nrf2 axisEndocrine journalFebruary 3, 2025Zheng L, Zhang C, Liao L, Hai Z, Luo X, Xiao H.St. Louis, MO, USA) for 24 h. 2. Cell transfection MiR-150-3p mimic (B02001), miR-150-3p inhibitor (B03001), and negative controls were obtained from GenePharma (Shanghai, China). ShRNAs (C02007) (sh-Gfi1 and

(7) Impact of Maternal BPA Exposure during Pregnancy on Obesity in Male Offspring: A Mechanistic Mouse Study of Adipose-Derived Exosomal miRNAEnviron Health PerspectJanuary 31, 2025Zhenyao Huang, Rui Niu, Qiaoqiao Xu, Rui Zhang, Weiyue Hu, Yufeng Qin, Xinru Wang, Qiujin Xu, Yankai Xia, Yun Fan, et al.(Cat# B02001) (sometimes represented by miR-124-3p+ in this study), and miR-124-3p inhibitor (Cat# B03001). The plasmids were stored at −20°C before use. Before use, they were centrifuged at 3,000 rpm for 3

(8) Tumor-associated macrophage-derived exosomal miR21-5p promotes tumor angiogenesis by regulating YAP1/HIF-1α axis in head and neck squamous cell carcinomaCellular and Molecular Life SciencesDecember 1, 2024Quan Yan, Jing Liu, Yiding Liu, Zhihao Wen, Dong Jin, Fu Wang, Lu Gaotransfect the cells with 10 nM miRNA inhibitor, miRNA mimic, NC inhibitor, and NC mimic (GenePharma, B03001, B02001, B04003, B04002, Shanghai, China). After a 6 h transfection incubation, the culture medium was

(9) MicroRNA-145-5p Regulates the Epithelial-Mesenchymal Transition in Nasal Polyps by Targeting Smad3Clinical and Experimental OtorhinolaryngologyMay 31, 2024Mengyu Zhang, Xiaole Peng, Xiaolong Liang, Wentao Wang, Yuqing Yang, Fan Xu, Xiaomin Lu, Dechun Geng, Manyi Lihuman TGF-β1 (HY-P7118, MedChemExpress). Synthesize miRNA mimic (B01001, GenePharma), miRNA inhibitor (B03001, GenePharma), and construct Smad3 lentiviral (D02001, GenePharma) transfected HNEpCs. Transfection was

(10) LncRNA MIR17HG Suppresses Breast Cancer Proliferation and Migration as ceRNA to Target FAM135A by Sponging miR-454-3pMolecular BiotechnologyDecember 1, 2023Jingjing Xu, Meishun Hu, Yang Gao, Yishu Wang, Xiaoning Yuan, Yan Yang, Wenjing Song, Weinan Yin, Pengju Gong, Lei Wei, et al.inhibitors were obtained from GenePharma in Shanghai for MIR17HG or FAM135A negative controls (B02001, B03001). Inoculate HEK293T cells at a density of 1 × 105 in a 24-well plate and harvest 60–80% density the

(11) Successful Transfection of MicroRNA Mimics or Inhibitors in a Regular Cell Line and in Primary Cells Derived from Patients with Rheumatoid ArthritisBIO-PROTOCOLSeptember 20, 2023Si Wang, Jing Xu, Yuanxu Guo, Yongsong Cai, Wenhua Zhu, Liesu Meng, Congshan Jiang, Shemin Lu(Invitrogen, catalog number: L300001)Mimics and inhibitors (GenePharma company, catalog number: B02001, B03001)0.25% Trypsin-EDTA (HyClone, catalog number: SH30042.01B)Fetal bovine serum (FBS) (Sangon biotechnology,

(12) LncRNA AC005332.7 Inhibited Ferroptosis to Alleviate Acute Myocardial Infarction Through Regulating miR-331-3p/CCND2 AxisKorean circulation journalMarch 1, 2023Dai R, Yang X, He W, Su Q, Deng X, Li J.antisense: 5′-UUCUAGGAUAGGCCCAGGGGC-3′, Cat.No: B02001), inhibitor (5′-TATGGTCCCAGGGATCCCAGA-3′, Cat.No: B03001) and the short hairpin RNA of CCND2 (sh-CCND2, 5′-CGACTTTAAGTTTGCCATGTA-3′, Cat.No:C02007), as well

(13) LncRNA MEG3 promotes cisplatin sensitivity of cervical cancer cells by regulating the miR-21/PTEN axisBMC CancerNovember 7, 2022Ying Du, Gang Geng, Chunquan Zhao, Tian Gao, Bin WeimiR-21 mimic (B01001, GenePharma, China), inhibitor NC (B04003, GenePharma, China), miR-21 inhibitor (B03001, GenePharma, China), siNC (A06001, GenePharma, China), siPTEN (A01004, GenePharma, China), pcDNA3.1

(14) MicroRNA Let-7a, -7e and -133a Attenuate Hypoxia-Induced Atrial Fibrosis via Targeting Collagen Expression and the JNK Pathway in HL1 CardiomyocytesInternational Journal of Molecular SciencesAugust 25, 2022Chien-Hsien Lo, Li-Ching Li, Shun-Fa Yang, Chin-Feng Tsai, Yao-Tsung Chuang, Hsiao-Ju Chu, Kwo-Chang UengID:MC12304, MC10050, MC12304) or inhibitor Negative Control, miRNA inhibitors (100 nM, GenePharma, Cat #B03001). The miRNA inhibitors were designed using the target mature miRNA and sequence as follows: mmu-miR-133a

(15) The diagnostic value of has_circ_0006423 in non-small cell lung cancer and its role as a tumor suppressor gene that sponges miR-492Scientific ReportsAugust 12, 2022Linwen Zhu, Lebo Sun, Guodong Xu, Jie Song, Bingchuan Hu, Zhongjie Fang, Yanggang Dan, Ni Li, Guofeng Shaocontrol empty pcDNA3.1 vector, miR-492 inhibitor and inhibitor NC (GenePharma, Shanghai, China, cat. no. B03001). All procedures were according to the manufacturers’ instructions. Fluorescence in situ hybridization

(16) MiR-25 blunts autophagy and promotes the survival of Mycobacterium tuberculosis by regulating NPC1iScienceMay 20, 2022Wenqi Dong et al.mimicCAUUGCACUUGUCUCGGUCUCUGA,GenePharma,B02003 control mimicUUCUCCGAACGUGUCACGUTT,GenePharma,B04002 miR-25 inhibitorUCAGACCGAGACAAGUGCAAUG,GenePharma,B03001 inhibitor controlCAGUACUUUUGUGUAGUACAA,GenePharma,B04001 NPC1 siRNAGAGGUACAAUUGCGAAUAUTT,GenePharma,A01001 NFKBIZ

(17) Mechanism of miR-132-3p Promoting Neuroinflammation and Dopaminergic Neurodegeneration in Parkinson’s DiseaseeneuroJanuary 4, 2022Xin Gong, Mengyi Huang, Lei Chenantibody,RRID:AB_2636859 DAPI,"C1002, Beyotime" MiRNA mimic,"B02003, GenePharma" MiRNA inhibitor,"B03001, GenePharma" Gene overexpression plasmid,"C05001, GenePharma" MiRNA antagomir,"B05001, GenePharma" Reagents

(18) miR-31 from Mesenchymal Stem Cell-Derived Extracellular Vesicles Alleviates Intervertebral Disc Degeneration by Inhibiting NFAT5 and Upregulating the Wnt/β-Catenin PathwayStem cells internationalJanuary 1, 2022Wang B, Xu N, Cao L, Yu X, Wang S, Liu Q, Wang Y, Xu H, Cao Y.Lipofectamine 3000 reagent (Gibco, Waltham, MA) with miR-31 mimic (B01001), mimic-NC (B04001), miR-31 inhibitor (B03001), and inhibitor-NC (B04003) (GenePharma, Shanghai, China). The NFAT5 coding sequence was amplified by

(19) The circular RNA circSLC7A11 functions as a mir-330-3p sponge to accelerate hepatocellular carcinoma progression by regulating cyclin-dependent kinase 1 expressionCancer Cell InternationalDecember 1, 2021Yu Huang, Wenhao Ge, Yuan Ding, Lufei Zhang, Jiarong Zhou, Yang Kong, Bijun Cui, Bingqiang Gao, Xiaohui Qian, Weilin WangChina). The miR-330-3p mimics, inhibitor, and negative control were synthesized by GenePharma (Cat# No. B03001; Shanghai, China). Lipofectamine 3000 reagent (Cat# No. L3000015; Invitrogen) was used as a transfection

(20) CircPTK2-miR-181c-5p-HMGB1: a new regulatory pathway for microglia activation and hippocampal neuronal apoptosis induced by sepsisMolecular MedicineDecember 1, 2021Min Li, Junwen Hu, Yucong Peng, Jingbo Li, Reng RenmiR-181c-5p mimics (B01001, 5′-AACAUUCAACCUGUCGGUGAGU-3′), mimic control (B04001), miR-181c-5p inhibitors (B03001, 5′-ACUCACCGACAGGUUGAAUGUU-3′), and inhibitor control (B04003) were purchased from GenePharma company

Be the First to Write a Review!

microRNA inhibitors from GenePharma

Description

GenePharma

Citations (31)

Reviews

microRNA inhibitors from GenePharma

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map