Negative control SuperSilencing shRNA plasmid expression vector from GenePharma

Product Specs
ItemNegative control SuperSilencing shRNA plasmid expression vector
CompanyGenePharma
Price $50.00Supplier Page View Company Product Page
Catalog NumberC03002
Quantity50 µg
PurityHPLC>95%
TypeshRNA
RNA TypeExpression Vectors

Add to Compare List

GenePharma

Suzhou GenePharma Co., Ltd.

199 Dongping Street

Suzhou Industrial Park, Suzhou 215125

China

Phone: +86-512-86668828
Fax: +86-512-86665900

Email: bd@genepharma.com

Company Profile

Website: http://www.genepharma.com

(1) Long noncoding RNA X‐inactive specific transcript (lncRNA XIST) inhibits hepatic insulin resistance by competitively binding microRNA‐182‐5pImmunity, Inflammation and DiseaseNovember 7, 2023Guoqing Zhong, Qingping Yang, Yihua Wang, Yuan Liang, Xiaojing Wang, Dongli ZhaoXIST short hairpin RNA (shXIST, C02001, cagaagaatggtacaaatccaag) and shRNA negative control (shNC, C03002) were purchased from GenePharma. Next, 2.5 μg of pCMV6‐XIST, pCMV6 empty vector, shXIST, and shNC, 100

(2) LncRNA NEAT1 Promotes Vascular Endothelial Cell Dysfunction via miR-218-5p/GAB2 and Serves as a Diagnostic Biomarker for Deep Vein ThrombosisClinical and Applied Thrombosis/HemostasisJune 15, 2023Shuping Wang, Fei Wang, Juan Ren, Hongyu Yangincubator. NEAT1 small interfering (si) RNA (si-NEAT1, C02004) and its negative control siRNA (si-NC, C03002), and overexpression plasmid of pcDNA3.1-NEAT1 and pcDNA3.1 were acquired from GenePharma Co. miR-218-5p

(3) Cancer stem cell-like cells-derived exosomal lncRNA CDKN2B-AS1 promotes biological characteristics in thyroid cancer via miR-122-5p/P4HA1 axisRegenerative TherapyMarch 1, 2023Qinghua Wu, Yonggang He, Xin Liu, Fangxiu Luo, Yimei Jiang, Ming Xiang, Ren ZhaoCDKN2B-AS1 plasmid (sh-CDKN2B-AS1 group) (C01001, GenePharma, China) and negative control (sh-NC group) (C03002, GenePharma, China) into TPC-1 and SW579 cells. On the other hand, in order to confirm the molecular

(4) SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosisOpen Med (Wars)February 14, 2023Huijin Zhao, Yuanyi Ding, Lan Zhang5′-CACCATCCACTACAACTACAT-3′), small-interfering RNA for NC (SiNC; A06001), and short-hairpin RNA for NC (ShNC; C03002) were designed and constructed by GenePharma (Shanghai, China). Subsequently, SiNC, NC, SiSIRT1, SiAPE1,

(5) PWAR6 interacts with miR‑106a‑5p to regulate the osteogenic differentiation of human periodontal ligament stem cellsMolecular medicine reportsApril 1, 2021Xiang J, Bian Y.vector were purchased from OriGene Technologies, Inc.), short hairpin (sh)RNA negative control (cat. no. C03002, shNC, Suzhou GenePharma Co., Ltd.), shPWAR6 (TGCTATCCTATTCATTTAGTATA, Suzhou GenePharma Co., Ltd.),

Be the First to Write a Review!

Negative control SuperSilencing shRNA plasmid expression vector from GenePharma

Description

GenePharma

Citations (5)

Reviews

Negative control SuperSilencing shRNA plasmid expression vector from GenePharma

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map