Validated SuperSilencing shRNA plasmid expression vector (pGPU6/Neo) from GenePharma

Product Specs
ItemValidated SuperSilencing shRNA plasmid expression vector (pGPU6/Neo)
CompanyGenePharma
Price $149.00Supplier Page View Company Product Page
Catalog NumberC02003
Quantity50 µg
PurityHPLC>95%
TypeshRNA
RNA TypeExpression Vectors

Add to Compare List

GenePharma

Suzhou GenePharma Co., Ltd.

199 Dongping Street

Suzhou Industrial Park, Suzhou 215125

China

Phone: +86-512-86668828
Fax: +86-512-86665900

Email: bd@genepharma.com

Company Profile

Website: http://www.genepharma.com

(1) MicroRNA-16 inhibits the TLR4/NF-ÎºB pathway and maintains tight junction integrity in irritable bowel syndrome with diarrheaJournal of Biological ChemistrySeptember 5, 2022Meijuan Xi, Ping Zhao, Fang Li, Han Bao, Sijie Ding, Lijiang Ji, Jing Yanoe-TLR42 group, and an oe-XIST group. Plasmids for silencing were synthesized from GenePharma (pGPU6/Neo, C02003). Plasmids for overexpression (pCDNA3.1- FLAG-LPA2 in overexpression groups) were purchased from Miaolingbio

(2) LncRNA LIFR‐AS1 overexpression suppressed the progression of serous ovarian carcinomaJournal of Clinical Laboratory AnalysisAugust 1, 2022Fang Liu, Linyan Cao, Yufang Zhang, Xinyi Xia, Yanhua Jiusing pCMV6‐Entry vector (PS100001, Origene), and short hairpin RNA targeting LIFR‐AS1 (shLIFR‐AS1, C02003, 5’‐TGGGACTTTGCGAATTACCTAAA‐3′) were purchased from GenePharma. LIFR‐AS1 overexpression plasmid, shLIFR‐AS1,

(3) miR-210-3p Promotes Lung Cancer Development and Progression by Modulating USF1 and PCGF3OncoTargets and TherapyJune 9, 2021Qian Chen, Hongyu Zhang, Jianyin Zhang, Le Shen, Jing Yang, Yan Wang, JinXiu Ma, Bing Zhuan(named sh-PCGF3-1 and sh-PCGF3-2) using BLAST. These shRNAs were constructed into pGPU6/Neo vectors (C02003, GenePharma, China) and transformed into MRC-5 cells, with scrambled shRNA as the negative control,

Be the First to Write a Review!

Validated SuperSilencing shRNA plasmid expression vector (pGPU6/Neo) from GenePharma

Description

GenePharma

Citations (3)

Reviews

Validated SuperSilencing shRNA plasmid expression vector (pGPU6/Neo) from GenePharma

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map