GoTaq 1-Step RT-qPCR System from Promega

Product Specs
ItemGoTaq 1-Step RT-qPCR System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA6020
Quantity5ml

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Syzygium cumini Fruit Extract and Quercetin Ameliorate Cadmium-Induced Ovarian Apoptosis in Rats Via miRNA- 204 - 5p-Mediated Bcl- 2 Upregulation and Bax/Caspase 9/Caspase 3 DownregulationBiological trace element researchDecember 1, 2025Abdel-Badeea WIE, Abdel-Wahab A, Mahmoud AA, Abdel-Razik AH, Attia EZ, Abdelmohsen UR, Hassanin KMA.GoTaq® 1-Step RT-qPCR System kit (Promega Corporation, 2800 Woods Hollow Road, Madison, WI 53711 USA; Catalog number: A6020) was used to perform a one-step qPCR assay on the rats’ ovarian mRNAs of Bcl- 2, Bax, caspase 3, caspase

(2) CDK1 drives SOX9-mediated chemotherapeutic resistance in gastric cancerJ Exp Clin Cancer ResOctober 8, 2025Marwah Al-Mathkour, Zheng Chen, Julio Poveda, Longlong Cao, Oliver G. McDonald, Dunfa Peng, Mohammed Soutto, Zhibin Chen, Heng Lu, Yan Guo, et al.transcribed as instructed (Promega, A5000). qRT-PCR was performed using GoTaq 2-Step qRT-PCR System (Promega, A6020). RT-qPCR was carried out using the CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories,

(3) Structural Proteins at Neuromuscular Junction Are Downgraded While NRG1 and Agrin Gene Expression Increases After Muscle InjuryBiomedicinesSeptember 16, 2025Jurandyr Pimentel Neto, Lara Caetano Rocha-Braga, Matheus Bertanha Fior, Paula Oliveira Camargo, Adriano Polican Ciena(NM_001271118.3). The assays were performed with the solutions contained in the GoTaq® 1-Step RT-qPCR System kit (A6020—Promega Corporation, Fitchburg, WI, USA), organized in duplicates in the plates (96 wells), where 4

(4) C-terminal tagging impairs AGO2 functionRNA BiolJuly 23, 2025Kunal M. Shah, Alex F. F. Crozier, Anika Assaraf, Muzjda Arya, Paul Grevitt, Faraz Mardakheh, Michael J. Plevin, Tyson V. Sharpcurves. Diluted RNA was assayed for AGO2 transcript using the GoTaq 1-Step RT-qPCR System (Promega A6020) with primers CTGGCTCCAGGGGACAAG (Forward primer) and CCACTCGGTACACAATCGCT (Reverse primer). Beta Actin

(5) Divergent actions of physiological and pathological amyloid-β on synapses in live human brain slice culturesNature communicationsApril 30, 2025McGeachan RI, Meftah S, Taylor LW, Catterson JH, Negro D, Bonthron C, Holt K, Tulloch J, Rose JL, Gobbo F, et al.plates (ThermoFisher:AB0800W) using BRYT Green Dye contained in the GoTaq 1-Step RT-qPCR kit (Promega: A6020) in the CFX96 Touch Real-Time PCR Detection system (Bio-Rad). We used 100 ng of RNA per reaction and

(6) Inflammatory conditions shape phenotypic and functional characteristics of lung-resident memory T cells in miceNature communicationsApril 16, 2025Schmidt A, Fuchs J, Dedden M, Kocher K, Schülein C, Hübner J, Vieira Antão A, Irrgang P, Oltmanns F, Viherlehto V, et al.manufacturer’s instructions. Samples were quantified by qRT-PCR (Go Taq 1-Step RT-qPCR kit, Promega, Cat: A6020) for the IAV M gene using the 7500 Real-Time PCR System (Applied Biosystems) and 7500 software v2.3.

(7) Tissue factor signalling modifies the expression and regulation of G1/S checkpoint regulators: Implications during injury and prolonged inflammationMolecular medicine reportsFebruary 1, 2025Featherby SJ, Faulkner EC, Ettelaie C.transcription (RT) and qPCR were carried-out sequentially using the GoTaq 1-Step RT-qPCR System (cat. no. A6020; Promega Corporation). GoTaq 1-Step RT-qPCR System contained GoScript Reverse Transcriptase and RNasin Plus RNase Inhibitor

(8) Induction of Apoptosis and Antiproliferative Activity of MCF-7 Human Breast Cancer Cells with Sonicated Aqueous Peel Extract of Punica granatum L. (Nimali sp.)Asian Pacific Journal of Cancer PreventionNovember 1, 2024Udeshika Yapa Yapa Bandara, Preethi Soysa, Chamindri Witharana5’-AGGAAGGAAGGCTGGAAGAGTG-3’. RT-qPCR analysis was executed using GoTaq® 1-step RT-qPCR kit (Cat No: A6020, Promega Corporation, 2800 Woods Hollow Road, Madison, USA. β-actin was used as the housekeeping gene

(9) Biochanin A attenuates spinal cord injury in rats during early stages by inhibiting oxidative stress and inflammasome activationNeural Regeneration ResearchSeptember 1, 2024Xigong Li, Jing Fu, Ming Guan, Haifei Shi, Wenming Pan, Xianfeng Loudetected using a qRT-PCR System (7500, ThermoFisher, Waltham, MA, USA) and a one-step qRT-PCR kit (A6020, Promega). The results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and quantified

(10) Metabolomic Profiling and In Vivo Antiepileptic Effect of Zygophyllum album Aerial Parts and Roots Crude Extracts against Pentylenetetrazole-Induced Kindling in MiceMetabolitesMay 30, 2024Asmaa R. Abdel-Hamed, Alaa S. Wahba, Dina M. Khodeer, Maged S. Abdel-Kader, Jihan M. Badr, Sebaey Mahgoub, Dina M. Halcaspase-1 genes were assessed using the GoTaq® 1-Step RT-qPCR System (Promega, Madison, WI, USA, Cat. No. A6020) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a reference gene. Table 1 shows the primer

(11) Comparative Bioinformatic Analysis Reveals Conserved Regions in SARS-CoV-2 Genome for RAPID Pandemic ResponseInternational Journal of Molecular SciencesMay 25, 2024Marcela Viviana Karpuj, D. R. Shaytov, Yonat Shemer-Avni, Michael Gideon, Zakharia M. Frenkel, Sarit Sivanunique primer sets in combination with the GoTaq® 1-Step RT-qPCR System protocol (Promega, Cat. No. A6020). Modifications included changes in duration and temperature of each stage, and we reduced the total

(12) HDAC activity is dispensable for repression of cell-cycle genes by DREAM and E2F:RB complexesNature CommunicationsMay 24, 2024Alison K. Barrett, Manisha R. Shingare, Andreas Rechtsteiner, Kelsie M. Rodriguez, Quynh N. Le, Tilini U. Wijeratne, Corbin E. Mitchell, Miles W. Membreno, Seth M. Rubin, Gerd A. Müller(Zymo Research, #R2053). One-step RT-qPCR was performed using the GoTaq 1-Step RT-qPCR System (Promega, #A6020) and MicroAmp Fast Optical 96 Well Reaction Plates (Applied Biosystems, #4346907) on a Quantstudio 3

(13) Phospholipase PLA2G7 is complementary to GPX4 in mitigating punicic-acid-induced ferroptosis in prostate cancer cellsiScienceMay 17, 2024Perrine Vermonden, Manon Martin, Katarzyna Glowacka, Ineke Neefs, Josef Ecker, Marcus Höring, Gerhard Liebisch, Cathy Debier, Olivier Feron, Yvan LarondelleCalcium phosphate transfection kit,Sigma Aldrich,Cat# CAPHOS GoTaq RTqPCR system,Promega Corporation,Cat# A6020 iScript cDNA synthesis kit,Bio-Rad,Cat# 1708890 MycoAlert Mycoplasma Detection kit,Lonza,Cat# LT07 Pierce

(14) A CRISPR interference system for engineering biological nitrogen fixationmSystemsMarch 19, 2024Steven J. Russell, Amanda K. Garcia, Betül Kaçartotal. RT-qPCR was performed using the BRYT Green dye-based GoTaq 1-Step RT-qPCR kit (Promega Cat. No. A6020) with nifH (Locus tag Avin_01380) and reference gene 16S rRNA (Locus tags Avin_55000, Avin_55030, Avin_55060,

(15) Exploring type I interferon pathway: virulent vs. attenuated strain of African swine fever virus revealing a novel function carried by MGF505-4RFront ImmunolMarch 11, 2024Juliette Dupré, Mireille Le Dimna, Evelyne Hutet, Pascal Dujardin, Aurore Fablet, Aurélien Leroy, Isabelle Fleurot, Grégory Karadjian, Ferdinand Roesch, Ignacio Caballero, et al.reverse transcription-quantitative PCR (RT-qPCR) using the GoTaq® 1-Step RT-qPCR system (Promega ref A6020). For each reaction, 80 ng of RNA in 5 µl final volume were added to the mix with experimental or control

(16) The Wnt/β-catenin pathway is important for replication of SARS-CoV-2 and other pathogenic RNA virusesnpj VirusesFebruary 21, 2024Zaikun Xu, Mohamed Elaish, Cheung Pang Wong, Bardes B. Hassan, Joaquin Lopez-Orozco, Alberto Felix-Lopez, Natacha S. Ogando, Les Nagata, Lara K. Mahal, Anil Kumar, et al.USA) and SARS-CoV-2 nucleocapsid mRNA level was determined by using Go-Taq 1-step RT-PCR Kit (Cat# A6020, Promega, Madison, WI). Briefly, 50 ng RNA from mouse lung was mixed with the 2019-nCoV_N2 primers (Cat#

(17) Differential RNA editing landscapes in host cell versus the SARS-CoV-2 genomeiScienceNovember 17, 2023Małgorzata Kurkowiak, Sarah Fletcher, Alison Daniels, Paweł Mozolewski, Domenico Alessandro Silvestris, Ewelina Król, Natalia Marek-Trzonkowska, Ted Hupp, Christine Tait-Burkardassays,Critical commercial assays,Critical commercial assays ,, GoTaq 1-Step RT-qPCR System,Promega,A6020 QIAamp Viral RNA Mini kit,Qiagen,52906 QIAwave RNA Mini Kit,Qiagen,74536 TruSeq Stranded Total RNA Library prep

(18) HDAC activity is dispensable for repression of cell-cycle genes by DREAM and E2F:RB complexesbioRxivNovember 3, 2023Alison Barrett, Manisha R. Shingare, Andreas Rechtsteiner, Tilini U. Wijeratne, Kelsie M. Rodriguez, Seth M. Rubin, Gerd A. Müller(Zymo Research, #R2053). One-step RT-qPCR was performed using the GoTaq 1-Step RT-qPCR System (Promega, #A6020) and MicroAmp Fast Optical 96 Well Reaction Plates (Applied Biosystems, #4346907) on a Quantstudio 3

(19) Ameliorative Effects of Zinc Oxide, in Either Conventional or Nanoformulation, Against Bisphenol A Toxicity on Reproductive Performance, Oxidative Status, Gene Expression and Histopathology in Adult Male RatsBiological Trace Element ResearchSeptember 8, 2023Dina M. M. H. El-Kossi, Shawky S. Ibrahim, Kamel M. A. Hassanin, Nashwa Hamad, Noha A. Rashed, Ahmed Abdel-WahabGoTaq® 1-Step RT-qPCR System kit (Promega Corporation, 2800 Woods Hollow Road, Madison, WI 53,711 USA; Catalog number: A6020) as instructed by the manufacturer. The relative quantification of mRNA expression was calculated using

(20) Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsisOpen Med (Wars)August 24, 2023Yangfa Chao, Wenting Huang, Zhiheng Xu, Ping Li, Shaodong Guthe RNA extraction kit (HYY0420-50, Huayueyang, China). Subsequently, the one-step RT-qPCR system (A6020) offered by Promega (USA) was applied to conduct the qRT-PCR reaction. The reaction system was done

Be the First to Write a Review!