PCR Master Mix from Promega

Product Specs
ItemPCR Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7505
Concentration2X
Quantity1,000 reactions

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Generation of Aptamers for the Selective Detection and Neutralization of soluble Lymphotoxin alphaMolecular Therapy Nucleic AcidsMarch 12, 2026Matthew Stephens, Eman Nassef, Pierre-Yves von der von der Weid10 min. Recovered aptamers were subsequently amplified using a Taq polymerase PCR mastermix (Promega M7502) with specific primers: forward, 5′-GCGGATGAAGACTGGTGT-3′; reverse, 5′-/5Phos/GTTGCTCGTATTTAGGGC-3′.

(2) Characterizing Plasmodium falciparum genetic diversity and complexity of infections in clinical malaria infections in Western and Coastal Kenya using the poly-alpha microsatellite markerMalar JDecember 19, 2025Nicole A. Abade, Cavin Mgawe, Leonard Ndwiga, Kelvin M. Kimenyi, Lynette Isabella Ochola-Oyierµl PCR reaction mixture contained 7.5 µl of 2X PCR Master Mix (Promega, Madison, WI, USA; Cat. No. M7505), 0.6 µl each of forward and reverse primers (10 µM), 2 µl of DNA template, and nuclease-free water

(3) A Maternal and Postnatal Ad Libitum Propionic Acid-Rich Diet in Mice Alters Intestinal Glia Proliferation and Inflammatory Response: Contrary to Effect in the BrainInternational Journal of Molecular SciencesSeptember 23, 2025Piotr P. Lagod, Latifa S. Abdelli, Saleh A. NaserWaltham, MA, USA). For each PCR reaction, 200 ng of DNA and the following master mix were used: Taq, Cat# M7502, (Promega, Madison, WI, USA). The primers that were used had the following sequence: Forward: 5′ ACT

(4) Identification of CaVβ1 Isoforms Required for Neuromuscular Junction Formation and MaintenanceCellsAugust 6, 2025Amélie Vergnol, Aly Bourguiba, Stephanie Bauché, Massiré Traoré, Maxime Gelin, Christel Gentil, Sonia Pezet, Lucile Saillard, Pierre Meunier, Mégane Lemaitre, et al.complementary DNA (cDNA). An amount of 2 µL of cDNA was amplified in 20 µL reactions in PCR Master Mix (M7505, Promega, Madison, WI, USA), Phusion High-Fidelity PCR Master Mix with GC Buffer (F532L, ThermoFisher Scientific

(5) Transmission of maternal oral pathobionts to the infant gut predisposes offspring to exacerbated enteritisCell ReportsJuly 22, 2025Masafumi Haraguchi, Yeji Kim, Natsuru Watanabe, Kyoko Yamazaki, Kira L. Newman, Merritt G. Gillilland, Yijie Guo, Daisuke Watanabe, Ingrid L. Bergin, Takehiro Suzuki, et al.Sciences,749625-0030 DNeasy Blood & Tissue Kit,QIAGEN,69506 E.Z.N.A.Total RNA Kit I,OMEGA,R6834-01 PCR Master Mix,Promega,M7502 SYBR Green PCR Master Mix,Thermo Fisher Scientific,4309155 Deposited data,Deposited data,Deposited

(6) Prime-boost vaccination with chimeric antigens adjuvanted in Montanide™ ISA50 V2 confers protection against experimental Lepeophtheirus salmonis infestation in Atlantic salmon (Salmo salar L.)Front ImmunolMay 21, 2025Alianet Rodríguez, Koestan Gadan, Lincidio Pérez, Øystein Evensen, Mario Pablo Estrada, Yamila Carpio(BT077866) (primers A and B) and β actin (EF490906.1) sequences (primers C and D). PCR Master Mix (M7502, Promega) was used for amplifications according to the manufacturer’s instructions. In these reactions,

(7) First report of potentially microcystin-producing Microcystis in the Dominican RepublicCurrent Research in Microbial SciencesMay 5, 2025Alfaniris Vargas Fernandez, Patri Ramírez Ramirez, Iris García Cruz, Claudia Reyes Gutierrez, Adrián Gutiérrez Cepeda, Alexander Valdez Disla, Roel Alejandro Chávez Luzania, Sergio de los Santos Villalobos, Pedro Leao, Vitor Vasconcelos(Chávez-Luzanía et al., 2024). The PCR reaction was carried out using the PCR Master Mix 2X PCR kit (Promega, M7502), using a total volume of 25 µL, which included the following components: 12.5 µL of PCR Master Mix

(8) Pre-clinical safety and efficacy of human induced pluripotent stem cell-derived products for autologous cell therapy in Parkinson's diseaseCell stem cellMarch 6, 2025Jeon J, Cha Y, Hong YJ, Lee IH, Jang H, Ko S, Naumenko S, Kim M, Ryu HL, Shrestha Z, et al.SsoAdvanced™ Universal SYBR® Green Supermix,Bio-Rad Laboratories,Cat#1725275 GoTaq® DNA Polymerase,Promega,Cat#M3001 PCR Master Mix,Promega,Cat#M7502 DNeasy Blood & Tissue Kit,Qiagen,Cat#69504 Venor GeM Mycoplasma Detection Kit,Sigma-Aldrich,Cat#MP0025 Neon™ Transfection System 100 μL Kit

(9) Uncovering the therapeutic potential of anti-tuberculoid agent Isoniazid in a model of microbial-driven Crohn’s DiseaseJournal of Crohn's and ColitisMarch 5, 2025Matthew Stephens, Keith Keane, Simon Roizes, Manon Defaye, Christophe Altier, Pierre-Yves von der Weidadded to 16 µL of premixed PCR master mix consisting of 10 µL 2× PCR master mix (Promega, Cat. No. M7502) and 0.5 µL of each TNF-specific primer (F′ AATGCACAGCCTTCCTCACAGAG, R′ AATTAGGGTTAGGCTCCTGTTTCC) designed

(10) RMRP variants inhibit the cell cycle checkpoints pathway in cartilage‑hair hypoplasiaMolecular Medicine ReportsJanuary 27, 2025Jian Gao, Junge Zheng, Shiguo Chen, Sheng Lin, Shan Duanperformed in a 25-µl volume, using ~25 ng gDNA as the template in a reaction with PCR Master Mix (cat. no. M7502; Promega Corporation). The thermal cycling amplification procedure consisted of 2 min at 95°C for pre-denaturation,

(11) An In Vivo Model of Propionic Acid-Rich Diet-Induced Gliosis and Neuro-Inflammation in Mice (FVB/N-Tg(GFAPGFP)14Mes/J): A Potential Link to Autism Spectrum DisorderInternational Journal of Molecular SciencesJuly 25, 2024Piotr P. Lagod, Latifa S. Abdelli, Saleh A. Naserand Reverse: 5′ AAG TCG ATG CCC TTC AGC TC 3′. PCR was performed using a PCR master mix (Taq, Cat# M7502, Promega, Madison, WI, USA) in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) using

(12) Prosaposin variants in sporadic, familial, and early-onset Parkinson's disease: a Taiwanese case–control study and meta-analysisScientific ReportsJanuary 26, 2024Ming-Che Kuo, Yung-Tsai Chu, Yu-An Su, Meng-Ling Chen, Ruey-Meei WuPCR reactions were performed in a total volume of 25 μl, containing 12.5 μl of PCR Master Mix (Cat.No: M7502, Promega), 9.5 μl nuclease-free water, 10 μM of forward-primer, 10 μM of reverse primer, and 200 ng

(13) Epigenetic Modulation of DDIT3 and MGMT Expression Acts Synergistically with Resistance to Imatinib towards CML Disease Progression: A Hospital based StudyAsian Pacific Journal of Cancer PreventionDecember 1, 2023Gautam Hazarika, Manash Jyoti Kalita, Simanta Kalita, Partha Pratim Das, Kalpajit Dutta, Lipika Lahkar, Anjanjyoti Rajkonwar, Mohammed Ghaznavi Idris, Vinotsale Khamo, Giriraj Kusre, et al.Hong et al., 2016). PCR amplification was carried out in Arktik Thermo-scientific using Master Mix (M7505 Promega). PCR products were analysed on 2.5% Agarose gels and visualized under Gel Documentation system

(14) Elucidation of GPR55-Associated Signaling behind THC and LPI Reducing Effects on Ki67-Immunoreactive Nuclei in Patient-Derived Glioblastoma CellsCellsNovember 17, 2023Kolbe MR, Hohmann T, Hohmann U, Maronde E, Golbik R, Prell J, Illert J, Strauss C, Dehghani F.Waltham, MA, USA, K1691) in 20 µL volume containing 10 µL PCR-MasterMix (Promega Inc., Madison, WI, USA, M7505), 0.5 µL forward and 0.5 µL reverse primer (25 pM), 0.25 µL of EvaGreen dye (Biotium, Fremont, CA, USA,

(15) A US-based national surveillance study for the susceptibility and epidemiology of Clostridioides difficile isolates with special reference to ridinilazole: 2020–2021Antimicrobial Agents and ChemotherapyOctober 18, 2023D. R. Snydman, L. A. McDermott, C. M. Thorpe, E. J. C. Goldstein, A. N. Schuetz, S. Johnson, D. N. Gerding, L. Gluck, D. Bourdas, K. C. Carroll, et al.were generated using PCR directly on 10-fold diluted cultures (in sterile H2O) (Promega MasterMix, M7502, Promega, Madison, WI, USA) with forward and reverse primers at 10 pmol/mcl. The forward primer was

(16) Genetic modification, characterization, and co-infection of Franken Sphingomonas and Anaplasma phagocytophilum in tick cellsSTAR ProtocolsSeptember 15, 2023Lorena Mazuecos, Almudena González-García, José de la FuentePCR Master Mix, Promega (https://www.promega.es/products/pcr/taq-polymerase/master-mix-pcr/?catNum=M7505#protocols).a.Run an agarose gel (1.25%) with 4 μL of PCR products to validate amplification and amplicon

(17) Serotype distribution and antibiotic resistance of Streptococcus pneumoniae isolates collected from unvaccinated children with pneumonia at a province in central VietnamIranian Journal of MicrobiologyDecember 19, 2022Bui Anh Son, Tang Xuan Hai, Tran Van Van Cuong, Duong Dinh Chinh, Thi-Hong-Hanh Le, Nguyen Manh Dung, Vu Nhat Dinh, Do Ngoc Anhreactions were carried out in 25 μl volumes containing 2 μl of DNA solution, 12.5 μl 2× Master mix (Cat.# M7505, Promega, USA), 0.5 μl of each primer (0.2 μM) and distilled water up to 25 μl. Thermal cycling was

(18) Genetic profiling of HSP70 gene in local Iraqi goatsBrazilian Journal of Veterinary MedicineOctober 5, 2022Hassan Nima Habib, Wessam Monther Mohammed Saleh, Qutaiba Jassim Gheni1μL of template DNA (75 ng), 1 μL of from each forward and reverse primer, 12.5 μL of master (Promega M7502) mix (2x) and 9.5 μLDNase (free water). The PCR conditions were as described by Fatima et al. (2019):

(19) Severe COVID-19 Pneumonia and Genetic Susceptibility: A Case Report and Literature ReviewCureusMarch 30, 2022Badr A Alsayed, Rashid Mirpmol of each of the primers given in Table 1 and 12 μL from Promega® PCR Master Mix (2x) (Cat. No. M7502-US) (Promega Corporation, Madison, Wisconsin, United States) and volume were adjusted to a final volume

(20) Prevalence, species distribution and antifungal susceptibility of Candida albicans causing vaginal discharge among symptomatic non-pregnant women of reproductive age at a tertiary care hospital, VietnamBMC Infectious DiseasesDecember 1, 2021Do Ngoc Anh et al.PCR reactions was Page 3 of 10 30 μl containing 3 μl of DNA solution, 15 μl 2X Master Mix (Cat.# M7505, Promega, USA), 0.75 μl of each primer (0.25 μM) and distilled water up to 30 μl. PCR amplification

Be the First to Write a Review!

PCR Master Mix

PCR Master Mix from Promega

Description

Promega

Citations (84)

Reviews

PCR Master Mix from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map