KAPA2G Fast HotStart ReadyMix from Roche

Product Specs
ItemKAPA2G Fast HotStart ReadyMix
CompanyRoche
Price Get Pricing Get Quote for this Product
Catalog Number07961227001
Quantity6.25 mL

Add to Compare List

Roche

Roche Diagnostics Corporation P.O. Box 50414 9115 Hague Road

Indianapolis, Indiana

United States

Phone: +1-800-262-1640
Fax: +1-800-428-2883
Technical Service Phone: +1-800-262-4911

Company Profile

Website: sequencing.roche.com

(1) Transcriptional cyclin-dependent kinases Cdk8 and Cdk19 are required for normal macrophage differentiationCell CycleDecember 17, 2025Aleksandra Kolodziejczyk, Samantha Liu, Fabian Strobel, Diego Martinez Martinez Alonso, Deborah Butter, Konrad Śnioch, Chen Chu, Henry Long, Veronika Sexl, Li Qiang, et al.5’TAGTAATGGGAGAAGGTCCTGAAAGG3’ All PCR reactions were performed using KAPA2G Fast HotStart PCR Kit (Roche, Cat. 07961227001) by initial denaturation of the DNA for 3 min at 95°C, followed by 35 cycles of amplification: 95°C

(2) An antisense RNA capable of modulating the expression of the tumor suppressor microRNA-34aCell Death & DiseaseJuly 3, 2018Jason T. Serviss et al.

Be the First to Write a Review!

KAPA2G Fast HotStart ReadyMix from Roche

Description

Roche

Citations (2)

Reviews

KAPA2G Fast HotStart ReadyMix from Roche

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map