GoTaq Colorless Master Mix from Promega

Product Specs
ItemGoTaq Colorless Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7132
Quantity100 reactions
Concentration2X
Molecular Weight~66kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) HAPI Cells are SIM-A9-related Mouse Microglial Cells Useful for In Vitro Modeling of Microglial ImmunometabolismbioRxivFebruary 16, 2026Ryan P. Mayers, Sausan M. Jaber, Nicolas Verhoeven, Ayodele Jaiyesimi, Brian M. Polsterperformed using a 50 μL reaction mix containing 25 μL of GoTaq 2x MasterMix (Promega; Madison, WI, Cat# M7132), 10 μM each of the corresponding forward and reverse primers, 4 μL of cDNA template, and nuclease-free

(2) Genomic insights into the functional and metabolic versatility of gut microbiome Anaerostipes speciesMicrob GenomFebruary 9, 2026Disha Bhattacharjee, Lindsey C. Millman, Meagan L. Seesengood, Lindsey M. Martineau, Anna M. Seekatzaliquots were heat-extracted at 95 °C for 20 min and prepared for PCR using GoTaq (Promega; catalogue no. M7132) with the 8F (5′-AGA GTT TGA TCC TGG CTC AG-3′) and 1492R (5′-GGT TAC CTT GTT ACG ACT T-3′) primers

(3) Isolation and long‐term culture of primary mouse cholangiocytes that retain biophysical properties and distinct Cl‐conductances: An initial studyPhysiological ReportsJanuary 20, 2026Qin Li, Youxue Wang, Kristy Boggs, Charles Kresge, Kari Nejak‐Bowenreaction mixture containing sequence‐specific primers (Table 1), GoTaq Master Mix (Promega, catalog no. M7132), and a 1/20 volume of cDNA. The mixture was subjected to 35 cycles of amplification (denaturation at

(4) CAPS-Based SNP Genotyping for Nitrogen-Response Phenotypes in Maize HybridsBIO-PROTOCOLDecember 20, 2025Jannis Jacobs, Linsey Newton, Brian McSpadden Gardener, Brandon Webster, Addie Thompson, Erich Grotewold, Peter K. Lundquist(Promega, catalog number: M7122); store at -20 °C 11. GoTaq Colorless Master Mix (Promega, catalog number: M7132); store at -20 °C 12. Milli-Q water Solutions 1. 5× TAE buffer (see Recipes) 2. 0.5× TAE (see Recipes) 3.

(5) Raw Milk as a Source of Campylobacter Infection: Isolation and Molecular Identification of Campylobacter coli and Campylobacter jejuni in EcuadorPathogensNovember 13, 2025Andrea Padilla-Cerda, Anthony Loor-Giler, Byron Puga-Torres, Silvana Santander-Parra, Luis Núñeza final volume of 10 µL, composed of GoTaq® Green Master Mix 2X (Promega Corporation, Wisconsin, CA M7132, USA). The total concentration of each primer was 3 µM, and 1 µL of diluted DNA (1:5) was utilized.

(6) Modeling chronic periodontitis in rats: Persistent alveolar bone loss mediated by periodontal pathogensAnimal Models and Experimental MedicineOctober 26, 2025Maksym Skrypnyk, Chun Xu, Shlomo Berkovsky, Thilini Jayasinghe, Axel SpahrμL and was prepared according to the manufacturer's instruction for GoTaq® Colorless Master Mix (Cat.M7132, Promega, USA). The following primer pair sequences were used in this study: P. gingivalis (fimA) F:

(7) Unraveling the Functional Impact of Splicing Variants in Inherited Hearing Disorders Through Minigene Splicing AssaysBiomedicinesSeptember 11, 2025Lara Emily Rosso, Giulia Pianigiani, Anna Morgan, Elisa Rubinato, Elisa Paccagnella, Stefania Lenarduzzi, Anita Wischmeijer, Beatrice Spedicati, Giorgia GirottoBIO-65053, Memphis, TN, USA). PCR analysis was performed with GoTaq DNA Polymerase (Promega, Cat. No. M7132, Madison, WI, USA) and vector-specific primers (Table 1). The cycling conditions were the following:

(8) Diversity and prevalence of Anaerostipes in the human gut microbiotabioRxivMay 25, 2025Disha Bhattacharjee, Lindsey C. Millman, Meagan L. Seesengood, Anna M. Seekatz95°C for 20 minutes and prepared for polymerase chain reaction (PCR) using GoTaq (Promega; catalog no. M7132), using the 8F (5’- AGA GTT TGA TCC TGG CTC AG -3’) and 1492R (5-’GGT TAC CTT GTT ACG ACT T-3’) primers

(9) Single-cell profiling of the amphioxus digestive tract reveals conservation of endocrine cells in chordatesScience AdvancesDecember 20, 2024Yichen Dai, Rongrong Pan, Qi Pan, Xiaotong Wu, Zexin Cai, Yongheng Fu, Chenggang Shi, Yuyu Sheng, Jingjing Li, Zhe Lin, et al.standard PCR with wild-type larvae cDNA as the template. qPCR was performed using 1X GoTaq SYBR Mix (Promega, M7132) with 20 ng of cDNA in a final volume of 20 μl. Each run consisted of one cycle of 5 min at 95°C followed

(10) Screening and identification of multiple antibiotic- resistant genes containing Salmonella Typhi from drinking water: A severe public health concern in BangladeshHeliyonNovember 30, 2024Sohana Akter Mina, Pabitra Debnath, A.K.M Zakir Hossain, Md Zahid Hasan, A.M Masudul Azad Chowdhuryliterature study [27,28]. Primer sequences are given in Table 1. The Go Taq 2X Promega green master mix (M7132) was used, and the PCR reaction mixture was prepared in a 1.5 mL sterilized eppendorf tube. Composition

(11) The adaptor protein 2 (AP2) complex modulates habituation and behavioral selection across multiple pathways and time windowsiScienceApril 19, 2024Rodrigo Zúñiga Mouret, Jordyn P. Greenbaum, Hannah M. Doll, Eliza M. Brody, Emma L. Iacobucci, Nicholas C. Roland, Roy C. Simamora, Ivan Ruiz, Rory Seymour, Leanne Ludwick, et al.commercial assays,Critical commercial assays,Critical commercial assays ,, GoTaq Mastermix,Promega,Cat# M7132 MEGAshortscript T7 Transcription kit,Ambion,Cat# AM1354 MEGAclear Transcription Clean-up kit,Ambion,Cat#

(12) Inherited Retinal Degeneration Caused by Dehydrodolichyl Diphosphate Synthase Mutation–Effect of an ALG6 Modifier VariantInternational Journal of Molecular SciencesJanuary 13, 2024Elisha Monson, Artur V. Cideciyan, Alejandro J. Roman, Alexander Sumaroka, Malgorzata Swider, Vivian Wu, Iryna Viarbitskaya, Samuel G. Jacobson, Steven J. Fliesler, Steven J. Pittlerverification (Table 4) [75]. PCR analysis was performed using GoTaq® Master Mix (Promega, Tokyo, Japan, Cat. #M7132) in BioRad iCycler™ or MyCycler™ PCR machines. Methods for PCR analysis were essentially as described

(13) The landscape of human SVA retrotransposonsNucleic Acids ResearchNovember 27, 2023Chong Chu, Eric W Lin, Antuan Tran, Hu Jin, Natalie I Ho, Alexander Veit, Isidro Cortes-Ciriano, Kathleen H Burns, David T Ting, Peter J Parkusing primer pairs as listed in Tab. S1-2 were performed using GoTaq Colorless Master Mix from Promega (M7132). PCR products were then run together on a 1.5% agarose gel for visualization and comparison with expected

(14) The Impact of ACE Gene Variants on Acute-Phase Reactants in Children with Rheumatic Heart DiseaseDiagnostics (Basel)May 9, 2023Abdulhadi H. Almazroea, Sondos Yousef, Salma M. S. Ahmad, Hanin N. AlHiraky, Amal Al-Haidose, Atiyeh M. AbdallahGo-Taq master mix including MgCl2, 10× PCR buffer, dNTPs, and 10 units of Taq DNA polymerase (Cat #M7132, Promega, Madison, WI, USA). A Veriti thermal cycler was used to amplify the PCR product (Life Technologies,

(15) Diversity and Prevalence of Clostridium innocuum in the Human Gut MicrobiotamSphereFebruary 21, 2023Disha Bhattacharjee, Clara Flores, Christine Woelfel-Monsivais, Anna M. Seekatzinnocuum. All isolates were heat extracted at 95°C for 20 min for PCR using Go Taq (Promega; catalog no. M7132) and 8F and 1492R primers to amplify the whole 16S rRNA gene (4). PCR products were cleaned up using)

(16) Osteoblast/osteocyte-derived interleukin-11 regulates osteogenesis and systemic adipogenesisNature CommunicationsNovember 23, 2022Bingzi Dong, Masahiro Hiasa, Yoshiki Higa, Yukiyo Ohnishi, Itsuro Endo, Takeshi Kondo, Yuichi Takashi, Maria Tsoumpra, Risa Kainuma, Shun Sawatsubashi, et al.“5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACACACACTGTGGGAAGG AAT-3” and “5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACCGAGACACACTGCAGAC-3” with GoTaq master mix (M7132; Promega, USA) or KOD FX Neo (KFX-201; Toyobo, Japan) according to the manufacturer’s protocol. Each

(17) Identification of the chloride channel, leucine-rich repeat-containing protein 8, subfamily a (LRRC8A), in mouse cholangiocytesHepatology (Baltimore, Md.)November 1, 2022Shcheynikov N, Boggs K, Green A, Feranchak AP.reaction mixture containing sequence-specific primers (Table S1), GoTaq Master Mix (Promega, catalog no. M7132), and a 1/20 volume of cDNA. The mixture was subjected to 35 cycles of amplification (denaturation at

(18) Iloprost requires the Frizzled-9 receptor to prevent lung canceriScienceJune 17, 2022Sompel K, Dwyer-Nield LD, Smith AJ, Elango A, Backos DS, Zhang B, Gross J, Ternyak K, Matsuda JL, Kopf K, et al.Normal Horse Serum,Vector laboratories,S-2012-50 TransIT-X2 Dynamic Delivery System,Mirus,#MIR6004 GoTaq,Promega,#M7132 PierceTM RIPA buffer,Thermo Scientific,#89900 Tween-20,Fisher BioReagents,#BP337-500 Sodium Dodecyl

(19) Discovery of indole-modified aptamers for highly specific recognition of protein glycoformsNature communicationsDecember 7, 2021Yoshikawa AM, Rangel A, Feagin T, Chun EM, Wan L, Li A, Moekl L, Wu D, Eisenstein M, Pitteri S, et al.added. 10 ng of dsDNA was subjected to eight cycles of PCR. A 2x GoTaq Master Mix was used (Promega, M7132) with 1 μM of each primer (100 μL reaction volume). The sequencing primers were added by using a Nextera

(20) Early life stress during the neonatal period alters social play and Line1 during the juvenile stage of developmentScientific ReportsDecember 1, 2021Amelia Cuarenta, Stacey L. Kigar, Ian C. Henion, Liza Chang, Vaishali P. Bakshi, Anthony P. AugerMx3000PTM real-time PCR system, and cDNA was amplified with Gotaq Colorless Master Mix (Promega; catalog #M7132), SYBR green (Invitrogen; catalog #S33102) and ROX as a reference dye (Invitrogen; 12223-012). Following

Be the First to Write a Review!