GoTaq Green Master Mix from Promega

Product Specs
ItemGoTaq Green Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7123
Quantity1,000 reactions
Concentration2X
Molecular Weight~66kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Genetic interaction between Adgrg6 and Sox9 reveals a feedforward mechanism for postnatal spinal stabilitybioRxivApril 8, 2026Valeria Aceves, Ziyi Xu, Cheng-Hai Zhang, Jongkil Kim, Joshua Ito, Kylie Mathers, Andrew B. Lassar, Zhaoyang Liu, Ryan S. GrayI,NEB,M0303A EcoRV-HF,NEB,R3195S Ethanol,"Decon Labs, Inc.",2716 Glycerol,Sigma Aldrich,G7893-500ML GoTaq Green,Promega,M7123 Instant Ocean Sea Salt,Instant Ocean,Instant Ocean Low Melt Agarose,IBI Scientific,IB70056 Methanol,Fisher

(2) Efficient genetic perturbation of murine sensory neurons in vivo using CRISPR/Cas9The Journal of PainApril 1, 2026Guadalupe García, Jacob B. Shapiro, Zachary T. CampbellOneC,Thermo Scientific, RNA Clean & Concentrator-5,Zymo Research,R1014 GoTaq Green Master Mix,Promega,M7123 HiScribe T7 High Yield RNA Synthesis Kit,New England Biolabs,E2040L "DNase I, RNase-free",Thermo Scientific,EN0521 Quick CIP

(3) Genetic Modification of Mice Using Prime EditingCurrent ProtocolsMarch 11, 2026Amr R. Salem, Xiaoling Xie, Susan H. Griffin, Lin Gan, Joseph M Miano(United States Biological, cat. no. T8655) Proteinase K (NEB, cat. no. P8107S) GoTaq Green master mix (Promega, cat. no. M7123) H2O, nuclease-free Agarose, type I, low EEO (Sigma-Aldrich, cat. no. A6013-500G) 10× TBE liquid concentrate

(4) Mapping the Mutational Landscape for Streptokinase Binding to PlasminogenbioRxivFebruary 4, 2026Srishti Baid, Matthew L Holding, Taylor Laurin, David Seimeiniak, David Ginsburg, Laura M Haynesmodified pAY-FE vector described above. The PCR products were further amplified with GoTaq (Product# M7123, Promega) using the same primers described above and gel purified using the Qiagen Gel Purification

(5) The Stathmin 1-lineage Contributes to Acinar Regeneration but not to Neoplasia Upon Oncogenic Kras ExpressionCellular and Molecular Gastroenterology and HepatologyJanuary 28, 2026Shakti Dahiya, Jorge R. Arbujas, Arian Hajihassani, Sara Amini, Michael Wageley, Klara Gurbuz, Zhibo Ma, Celina Copeland, Mohamed Saleh, George K. Gittes, et al.Transnetyx or using KAPA Express Extract Kit (Fisher Scientific, 50-196-5275) and GoTaq Master Mix (Promega, M7123). Primers per mouse line were used as follow: Stmn1CreERT2: Forward: 5'- ACCTGAAGATGTTCGCGATTATCT -3',

(6) Targeting SMPDL3B to Ameliorate Radiation- and Cisplatin-Induced Renal ToxicityCellsJanuary 22, 2026Anis Ahmad, Shamroop Kumar Mallela, Saba Ansari, Mohammed Alnukhali, Sandra Merscher, Alla Mitrofanova, Youssef H. Zeidan, Alan Pollack, Alessia Fornoni, Brian Marplesnumber 74106) from Qiagen (Hilden, Germany) for RNA extraction, GoTaq Green Master Mix (catalog number M7123) from Promega (Madison, WI, USA) for PCR amplification, qScript cDNA SuperMix (catalog number 95048-500)

(7) The transcription factor HHEX maintains glucocorticoid levels and protects adrenals from androgen-induced lipid depletionNature CommunicationsJanuary 11, 2026Typhanie Dumontet, Kaitlin J. Basham, Micah C. Foster, Emma Silverman, Kyle A. Heard, Dominque Johnson, Chaelin Lee, Samuel W. Plaska, David T. Breault, David Penton, et al.2 µL of genomic DNA were added to a mix comprised of 10 µL of 2× GoTaq® Green Master Mix (Promega, #M7123), combined with 1 µL of each primer (10 µM) and milli Q water for a final volume of 20 µL. Genotyping

(8) A Rapid, Cost-Effective RNA Recovery of Cowpea Mild Mottle Virus (CPMMV) Directly from PCR Tubes Adsorption for Routine-Scale Detection in SoybeanVirusesDecember 25, 2025Pedro Henrique Ribeiro, Marcos R. Ribeiro-Junior, Bárbara R. R. Silveira, Francisco M. Ochoa-Corona, Renate Krause-SakateM-MLV reverse transcriptase (Promega, Madison, WI, USA, cat. #M1701) and GoTaq Green Master Mix (Promega, cat. #M7123), with the primer pair CPMMV1280-F and CPMMV1696-R [13] (10 pmol each). Reaction volume was 12.5 µL

(9) Comparative analysis of butternut (Juglans cinerea) and Japanese walnut (Juglans ailantifolia) chloroplast genomesBMC Plant BiologyDecember 8, 2025Aziz Ebrahimi, Mojtaba Zamani Faradonbeh, Abdullah, Samarth Mathur, Martin Williams, Anna O. Conrad, Douglass F. Jacobssynthesized by Integrated DNA Technologies (IDT). PCR amplifications used GoTaq® Green Master Mix (cat. no. M7123; Promega). The annealing temperature (Tm) was 57 °C for all primer pairs, except for marker CPS03-ycf1,

(10) Mice carrying the homologous human shelterin POT1-L259S mutation linked to pulmonary fibrosis show a telomerase deficiency-like phenotype with telomere shortening with increasing mouse generationsGenes & developmentDecember 1, 2025Sánchez-Vázquez R, Burgaz García-Oteyza S, Serrano R, Flores JM, Martínez P, Blasco MA.was performed with the QuantStudio 6 Flex (Applied Biosystems) using GoTaq Green master mix (Promega M7123). For detection of hTR, the primers used were hTR-F (GAAGAGGAACGGAGCGAGTC) and hTR-R (CATGTGTGAGCCGAGTCCTG).

(11) Removal of developmentally regulated microexons has a minimal impact on larval zebrafish brain morphology and functioneLifeNovember 18, 2025Caleb C S Calhoun, Mary E S Capps, Kristie Muya, William C Gannaway, Verdion Martina, Claire L Conklin, Morgan C Klein, Jhodi M Webster, Emma G Torija-Olson, Summer B ThymeiScript Reverse Transcription Supermix (Bio-Rad #1708840). Following PCR with GoTaq polymerase (Promega M7123) and primers (Supplementary file 1), samples were run on a 4% agarose gel and the band intensities were

(12) Efficient genetic perturbation of murine sensory neurons in vivo using CRISPR/Cas9bioRxivOctober 24, 2025Guadalupe García, Jacob B. Shapiro, Zachary T. CampbellOneC,Thermo Scientific, RNA Clean & Concentrator-5,Zymo Research,R1014 GoTaq Green Master Mix,Promega,M7123 HiScribe T7 High Yield RNA Synthesis Kit,New England Biolabs,E2040L "DNase I, RNase-free",Thermo Scientific,EN0521 Quick CIP

(13) Niche formation of Rozellomycota in wastewater treatment model reactorsSci RepOctober 15, 2025Katrin Stüer-Patowsky, Eva Gega, Lijia Cao, Christian Wurzbachergel electrophoresis. The PCR was performed in 25 μL reactions with 12,5 μL GoTaq Green Master Mix (Promega, #M7123), 5 pmol of each primer, and 1 μL template. We ran an initial denaturation of 2 min at 95 °C, then 25

(14) PAK4 promotes vertex remodeling to maintain epithelial integrity and barrier functionbioRxivOctober 6, 2025Babli Adhikary, Alexander Chang, Atsuko Y. Higashi, Hideki Chiba, Ann L. Miller, Tomohito Higashicolonies. Genomic DNA was extracted from cell clones and screened by PCR using GoTaq DNA polymerase (#M7123; Promega, Madison, WI, USA) and specific primers. PCR products of KO clones were sequenced (Macrogen,

(15) Detection of Loss of Heterozygosity in Tk-Deficient Mutants from L5178Y Tk+/−-3.7.2C Mouse Lymphoma CellsMethods in Molecular BiologySeptember 22, 2025Xiaoqing Guo, Ying Chen, Martha M. Moore, Nan MeiPhosphate buffered saline, #10010023 (ThermoFisher Scientific Inc.; Waltham, MA). GoTaq® green master mix for PCR, #M7123 (Promega Co.; Madison, WI). Proteinase K solution, #MC5008 (Promega). Forward and reverse primers

(16) Exogenous pyruvate is therapeutic against colitis by targeting cytosolic phospholipase A2Genes & DiseasesSeptember 1, 2025Sadaf Hasan, Nabil Ghani, Xiangli Zhao, Julia Good, Chuan-ju Liubefore proceeding with experiments.49 For PCR amplification, GoTaq green master-mix (10 μL, Promega, M7123) and 1 μL of each of the forward and reverse primers from 100 μM stock (Integrated DNA Technologies,

(17) Discovery of a novel lymphocytic choriomeningitis virus strain associated with severe human disease in immunocompetent patient, New MexicoEmerg Microbes InfectAugust 21, 2025Jordan T. Gass, Robert A. Nofchissey, Frances M. Twohig, Chunyan Ye, Samuel M. Goodfellow, Kimiknu Mentore, Marcos Burgos, Oscar Negrete, Shannon Whitmer, John D. Klena, et al.primer (Supplemental Table 1), and standard reagents for the GoTaq green master mix (catalog number M7123; Promega). Thermocycler conditions were identical to the initial screening with the addition of a 5-min

(18) Genome-wide in vivo CRISPR screens identify GATOR1 complex as a tumor suppressor in Myc-driven lymphomaNat CommunAugust 21, 2025Margaret A. Potts, Shinsuke Mizutani, Yexuan Deng, Srimayee Vaidyanathan, Keziah E. Ting, Göknur Giner, Shruti Sridhar, Girija Shenoy, Yang Liao, Sarah T. Diepstraten, et al.tail lysis buffer (Viagen Biotech) and Proteinase K. Mastermix was prepared with GoTaq green (Promega, M7123) containing primers (final concentration 0.5 pmol/mL) with the addition of 1 µL total DNA. PCR cycling

(19) Amino acid competition shapes Acinetobacter baumannii gut carriageCell Host MicrobeAugust 13, 2025Xiaomei Ren, R. Mason Clark, Dziedzom A. Bansah, Elizabeth N. Varner, Connor R. Tiffany, Kanchan Jaswal, John H. Geary, Olivia A. Todd, Jonathan D. Winkelman, Elliot S. Friedman, et al.Kit,Qiagen,Cat# 51804 QIAprep Spin Miniprep Kit,Qiagen,Cat# 27106 Promega GoTaq PCR Green Mix,Promega,Cat# M7123 NEB DNA HIFI Assembly,NEB,Cat# E2621L Q5® High-Fidelity 2X Master Mix,NEB,Cat# M0492S Breathe-Easy

(20) Comprehensive resolution and classification of the Epstein Barr virus transcriptomeNat CommunJuly 10, 2025Truong D. Nguyen, Jia Wang, Meggie T. Lam, Harris McFerrin, Tina M. O'Grady, Claire Roberts, Nicholas Van Otterloo, Trang T. Nguyen, Melody Baddoo, Dorota Wyczechowska, et al.used for cDNA synthesis. The PCR reaction was performed using GoTaq® Green Master Mix (catalog No. M7123) from Promega, USA and equal amounts of cDNA volumes were used for PCR reactions. PCR primers for BLLF1-v2

Write a Review

(1)

7/17/2020Efficient Amplification of DNA Using GoTaq® Green Master Mix Xiaoguang LiI recommend this because it saves a lot of time, and works well. I didn't recycle the gel product.