GoTaq Green Master Mix from Promega

Product Specs
ItemGoTaq Green Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7122
Quantity100 reactions
Concentration2X

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Bioremediation Potential of Leaf Endophytic Fungi in Allium ampeloprasum and Brassica oleracea var. capitataJ Fungi (Basel)April 20, 2026Dayani Pavalakumar, Sagarika Kannangara, Nadeema Dharmasiri, Chamani Amarasekara, Lanka Undugoda, Kasun M. Thambugala, Jayantha Munasinghe, Sukanya Haituk, Ratchadawan Cheewangkoon(5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) primers, 12.5 µL of GoTaq Green Master Mix (M7122, Promega, Madison, WI, USA), and 8.5 µL of nuclease-free water. Amplification was carried out using

(2) Fertilization with Protamine-2 deficient sperm triggers abnormal pronucleus development and zygotic cleavage†Biology of ReproductionApril 13, 2026Shannon R Rainsford, Kevin Tse, Benjamin William Walters, Jong-Nam Oh, Kaelyn Sumigray, Bluma J Lesch, Zachary D Smith(Supplemental Figure 1B). Polymerase chain reaction was performed using a GoTaq master mix (Promega M7122) and samples were run on a 1.5% agarose gel and visualized using a Syngene G:Box imager. Sperm preparation Adult

(3) Lipid droplet-induced T cell death sustains autoimmune tissue inflammationCell MetabolismApril 7, 2026Jitendra Kumar, Yoshinori Takashima, Jose Morales, Brandon Wong, Lina Werner, Isabel N. Goronzy, Selene Rubino, Robert T. Trousdale, Gerald J. Berry, Jörg J. Goronzy, et al.proteins","Chemicals, peptides, and recombinant proteins" All-in-One Optimized PCR Master mix,Promega,# M7122 BODIPY™ 493/503,ThermoFisher,# D3922 BODIPY™ 581/591 C11 (Lipid Peroxidation Sensor),ThermoFisher,#D3861 "Bovine Serum Albumin (BSA

(4) Variant-to-gene mapping identifies ARHGEF12 as a primary open-angle glaucoma effector gene operating within retinal ganglion cellsbioRxivMarch 30, 2026Vrathasha Vrathasha, Matthew C. Pahl, James A. Pippin, Sergei Nikonov, Jie He, Mina Halimitabrizi, Laxmi Moksha, Rebecca Salowe, Amy-Ann Edziah, Yuki Bradford, et al.and Qubit 2.0 fluorometer. PCR was performed using the GoTag Green Master Mix (Promega, catalog #: M7122, Madison, WI, USA), and the primer sets are listed in Table S8. PCR products were purified using Gel

(5) AAV2-mediated intravitreal delivery of exon-specific U1 snRNA rescues optic neuropathy in familial dysautonomiaMolecular Therapy Nucleic AcidsMarch 12, 2026Anil Chekuri, Krishnakanth Kondabolu, Emily G. Kirchner, Swanand Koli, Matthew Chagnon, Drenushe Krasniqi-Vanmeter, Max E. Stern, Jessica Bolduc, Giulia Romano, Franco Pagani, et al.starting RNA equivalent cDNA was subjected to a PCR reaction with the GoTaq green master mix (Promega, #M7122) and 30 amplification cycles (94°C for 30 s, 58°C for 30 s, and 72°C for 30 s). The human-specific forward

(6) Alpha-Actinin-3 Deficiency Links Genetic Susceptibility to Renal Fibrosis: Evidence From Hemodialysis Patients and Murine ModelsFASEB JFebruary 28, 2026Raisa B. Santos, Hellena Storch Vieira, Alice K. Scheer, Larissa R. Ribeiro, Cledia F. Silva, Rafael B. Orcy, Ines Schadock, Alexandre Budu, Ronaldo Carvalho Araujo, Augusto Schneider, et al.protocol described by Schadock et al. [19] was followed, using 2× GoTaq Green Master Mix (Promega, Cat. M7122). Each sample was independently genotyped by two different researchers, and results were considered

(7) Butyrate improves dextran sulfate sodium-induced imbalance of intestinal stem cell homeostasis in broilersPoultry ScienceFebruary 1, 2026Ran Li, Tao Quan, Yaoxing Chen, Ting Gaopolymerase chain reaction (PCR). The general PCR amplification system contained 2 μL of sample cDNA, 10 μL of GoTaq®Green Master Mix (M7122, Promega, USA), 0.2 μL of primers, and 7.2 μL of ddH2O. PCR was performed with an initial incubation

(8) Tyrosinase-Deficient Skin Melanophore Lineage in Xenopus tropicalis Tadpoles Shows Strong AutofluorescenceInternational Journal of Molecular SciencesJanuary 29, 2026Yuyan Jiang, Yijian Chen, Zeri Huang, Lian Chen, Xiao HuangPCR. All the genotyping PCRs were performed using GoTaq® Green Master Mix (Promega, Beijing, China, M7122) according to the manufacturer’s protocol. For the Tyr-locus knockin experiment, primer sequences used

(9) A fully synthetic Golden Gate assembly system for engineering a Pseudomonas aeruginosa phiKMV-like phageProceedings of the National Academy of SciencesJanuary 27, 2026Andrew P. Sikkema, Kaitlyn E. Kortright, Hemaa Selvakumar, Jyot Antani, Benjamin K. Chan, Matthew Davidson, Max Hopkins, Benjamin Newman, Vladimir Potapov, Cecilia A. Silva-Valenzuela, et al.1 µL was used as PCR template. Reactions were carried out using 2× GoTaq Green Master Mix (Promega, M7122) and visualized on 1% agarose gels. Microscopy. Bacterial cultures of P. aeruginosa PAO1 were grown

(10) AAV-mediated exon skipping therapy for Usher syndrome, type 2AMolecular TherapyJanuary 7, 2026Stephanie A. Mauriac, Jiyoon Lee, Jingyuan Zhang, Jiahe Jin, Carl Nist-Lund, Camille T. Martin, Cristobal R. Von Muhlenbrock, Sydney O’Malley, Mary G. Chaves, Margot A. Madison, et al.Ipswich, MA, USA). Polymerase Chain Reaction (PCR) were performed using GoTaq® Master Mix (Promega, #M7122, Madison, WI, USA) and primer sets included in Table S8. For the Ush2a genotyping, the PCR reaction

(11) Functional analysis of AIP variants in a cohort of neuroendocrine neoplasmsEndocrine-Related CancerJanuary 1, 2026Blanca R Carranza-Zavala, Julia M Zuarth-Vázquez, Susana M López-Zelocualtecatl, Claudia Ramírez-Rentería, Maribel Rodríguez-Torres, Ernesto Sosa-Eroza, Baldomero González-Virla, Armando Gamboa-Domínguez, Alfredo A Reza-Albarrán, Laura C Hernández-Ramírezsamples. Endpoint polymerase chain reaction (PCR) was carried out with GoTaq master mix (Promega, USA, M7122) and the following primers: 5′-CAGCCCACGGTGACAGAG-3′ and 5′-GTTCACGCATCTGTGCAACAC-3′ for

(12) Speed Breeding Transgenic American Chestnut Trees Toward RestorationPlant DirectDecember 22, 2025Thomas Klak, Hannah Pilkey, Virginia G. May, Dakota Matthews, Allison D. Oakes, Ek Han Tan, Andrew E. Newhouseexpected PCR sizes are provided in Table S1. PCR was performed using 2x GoTaq Green Mastermix (Promega M7122). Approximately 2 ng of DNA were used per 20 μL PCR reactions containing 2 μM of each primer. All reactions

(13) CAPS-Based SNP Genotyping for Nitrogen-Response Phenotypes in Maize HybridsBIO-PROTOCOLDecember 20, 2025Jannis Jacobs, Linsey Newton, Brian McSpadden Gardener, Brandon Webster, Addie Thompson, Erich Grotewold, Peter K. LundquistNuclease-free water (Promega, catalog number: MC1191) 10. GoTaq Green Master Mix (Promega, catalog number: M7122); store at -20 °C 11. GoTaq Colorless Master Mix (Promega, catalog number: M7132); store at -20 °C 12.

(14) Decapitation Rapidly Triggers Axillary Bud Release via Regulatory Network Reprogramming in Nicotiana tabacumPlants (Basel)December 16, 2025Bingxin Xu, Qingsong Liu, Genhong Wang, Siyu Shao, Ping Zhao, Qingyou Xiaunder control of the CaMV-35S promoter. PCR was performed using GoTaq® Green Master Mix (Promega, Cat. #M7122, Madison, WI, USA) according to the manufacturer’s instructions. Positive PCR products were subsequently

(15) Low Inducer Concentrations at 10°C Promotes Soluble Recombinant Expression of Aedes aegypti Mosquito Midgut Proteases in E. coliResearch SquareDecember 11, 2025Daniel Fong, Neomi Millan, My Anh Le, Elizabeth Moreno-Galvez, Kevin Derisier, Abigail G. Ramirez, Kaelyn Pluta, Kimberly Houghton, Alberto A. Rascón(as prepared in Rascon et al 2011) were co-incubated with the GoTaq Green Master Mix (Promega, cat. #M7122, Madison, WI) and amplified following the manufacturer’s protocol but with an annealing temperature

(16) In silico identification and ex vivo evaluation of Toxoplasma gondii peptides restricted to HLA-A*02, HLA-A*24 and HLA-B*35 alleles in human PBMC from a Colombian populationMedical Microbiology and ImmunologyDecember 1, 2025Mónica Vargas-Montes, María Camila Valencia-Jaramillo, Juan David Valencia-Hernández, Jorge Enrique Gómez-Marín, Ailan Farid Arenas, Néstor CardonaOligoAnalyzer). The PCR amplification was performed using GoTaq® Green Master Mix (Promega. Reference M7122), with primers at a final concentration of 0.4 µM, and 100 ng of DNA per sample. Allele-specific amplification

(17) Conversion of elite bread wheat cultivars HD3086 and HD2932 into cytoplasmic male sterile (CMS) lines and their genetic assessment to develop CMS-based hybridsBMC Plant BiologyNovember 11, 2025Abhimanyu Singh Malik, Gulab Chand, Hemant Sharma, Mallana Gowdra Mallikarjuna, Parvesh Kumar, Nand Kishor Sharma, Braj Kishore Meena, Niranjana M, Niharika Mallick, Vinod, et al.markers was performed in a 10 µL reaction volume containing 4 µL of 2X GoTaq PCR Master Mix (Promega, #M7122), 1 µL of each primer (5 pmol/µL), 2 µL of nuclease-free water, and 2 µL of genomic DNA (25 ng/µL, total

(18) LRRC8A Regulates Outer Hair Cell Volume and Electromotility and is Required for HearingAdvanced ScienceNovember 1, 2025Shengnan Wang, Yuehui Xi, Qiaojun Fang, Sai Shi, Fei Wang, Fuyu Xian, Zhongyang Zhang, Yuxin Yang, Xishuo Jin, Xiaomin Wang, et al.commercial sources: PrimeScript RT reagent kit (6210A) from Takara‐Clontech (Invitrogen) and PCR reagents (M7122) from Promega (Madison, WI, USA). Table S3 (Supporting Information) lists the primer sequences. Electrophysiology To

(19) Primordial germ cell specification and early developmental cell states in Pacific oysterBMC GenomicsOctober 23, 2025Mackenzie R. Gavery, Lauren E. Vandepas, Lauren M. Saunders, Brent Vadopalas, J. Adam Luckenbach, Cole Trapnell, Steven Robertsvolume consisting of 9.5 µL nuclease-free water, 12.5 µL GoTaq master mix (Promega, Catalog Number: M7122), 1 µL 10 µM forward primer, 1 µL 10 µM reverse primer, 1 µL cDNA template. Amplification was performed

(20) Individual peroxiredoxin or Tor pathway components are not required for circadian clock function in Neurospora crassaFungal BiologyOctober 1, 2025Christina M. Kelliher, Jay C. Dunlap102-T # NC9724951) according to the manufacturer’s instructions. GreenTaq PCR Master Mix (Promega # M7122) was used for genotyping. Relevant genotyping primers for key strains are: NCU03151: 5’ – TGGAGTGTAGGCCATCTGGA

Write a Review

(1)

7/17/2020Efficient Amplification of DNA Using GoTaq® Green Master Mix Xiaoguang LiI recommend this because it saves a lot of time, and works well. I didn't recycle the gel product.
(1)

7/23/2019Promega's PCR Master Mix for Colony PCR Works Well Atul SinghBest kit I have used so far for colony PCR.
(1)

1/28/2019Very Easy and Efficient Taq Mastermix Virginia FolgadoI needed a cheap and efficient PCR mix since I have to do a lot of PCR from bacteria colonies to check presence/absence of my target insert in the plasmid. I found this kit very easy to use; I didn't ... Read Review
(1)

8/15/2017Great PCR Master Mix Chris C We use this PCR master mix for genotyping PCR reaction for transgenic mice. We selected this product because of its ease of use, just add primers, water and template. It works well for our PCR ... Read Review
(1)

12/29/2016Super Easy PCR Premix Zeji DuGoTaq Green Master Mix is a premixed ready-to-use solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for efficient amplification of DNA templates by ... Read Review
(1)

10/14/2015Premixed and Ready-To-Use Solution for DNA Synthesis Sunita MeenaGoTaq® Green Master Mix was mixed with primers which are specific for the gene of interest present in cDNA and kept in PCR machine for amplification. The PCR product was directly visualized in ... Read Review