ImProm-II Reverse Transcriptase from Promega

Product Specs
ItemImProm-II Reverse Transcriptase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3801
Quantity10 reactions

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(21) Enhancement of SMN protein levels in a mouse model of spinal muscular atrophy using novel drug‐like compoundsEMBO Molecular MedicineJuly 1, 2013Jonathan J. Cherry, Erkan Y. Osman, Matthew C. Evans, Sungwoon Choi, Xuechao Xing, Gregory D. Cuny, Marcie A. Glicksman, Christian L. Lorson, Elliot J. Androphy(Invitrogen 15596-026). cDNA was generated using the Improm-II Reverse Transcription System (Promega A3801). The forward primer pair recognizes the exon 5–6 junction, which includes a restriction site that was

(22) Structure based identification and characterization of flavonoids that disrupt human papillomavirus-16 E6 functionPloS oneJanuary 1, 2013Cherry JJ, Rietz A, Malinkevich A, Liu Y, Xie M, Bartolowits M, Davisson VJ, Baleja JD, Androphy EJ.(Invitrogen 15596-026). cDNA was generated using the Improm-II Reverse Transcription System (Promega A3801). qPCR was performed as described in the protocol for SsoFast EvaGreen supermix (BioRad 172-5023) using

(23) Identification of Novel Compounds That Increase SMN Protein Levels Using an Improved SMN2 Reporter Cell AssayJ Biomol ScreenApril 1, 2012Jonathan J. Cherry, Matthew C. Evans, Jake Ni, Gregory D. Cuny, Marcie A. Glicksman, Elliot J. Androphy(Invitrogen 15596-026). cDNA was generated using the Improm-II Reverse Transcription System (Promega A3801). The forward primer pair recognizes the exon 5–6 junction, which includes a restriction site that was

(24) Differential regulation of the SMN2 gene by individual HDAC proteinsBiochemical and Biophysical Research CommunicationsOctober 14, 2011Matthew C. Evans, Jonathan J. Cherry, Elliot J. Androphy(Invitrogen, #15596–026). cDNA was generated using the Improm-II Reverse Transcription System (Promega, #A3801). Primer sequences: Exon5/Xho-forward: catttccttctggaccactcgag, Exon6-forward: gcccaaatctgctccatggaac,

Be the First to Write a Review!