SP6 Promoter Primer from Promega

Product Specs
ItemSP6 Promoter Primer
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberQ5011
TargetSP6
Quantity2microg
Nucleic Acid TypeSP6 Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Isolation and next generation sequencing of archival formalin‐fixed DNAJournal of AnatomyMay 19, 2020Ahlam Alqahtani, Andrew Skelton, Lorraine Eley, Srinivas Annavarapu, Deborah J. Henderson, Bill Chaudhryinstructions. Plasmid insert DNA was subjected to Sanger sequencing using both forward SP6 (Cat. No. Q5011, Promega) and reverse T7 (Cat. No. Q5021, Promega) direction primers. 2.6 Next generation exome sequencing Libraries

(2) Improving sensitivity of single tube nested PCR to detect fastidious microorganismsHeliyonJanuary 27, 2020Diala Shatleh-Rantisi, Asmaa Tamimi, Yaqoub Ashhabcontaining the selected insert was sequenced using the SP6 Promoter Primer (TATTTAGGTGACACTATAG) (Cat # Q5011, Promega) and the T7 Promoter Primer (TAATACGACTCACTATAGGG) (Cat # Q5021, Promega). Sanger sequencing

(3) A novel assay to detect calreticulin mutations in myeloproliferative neoplasmsOncotargetJanuary 24, 2017Valentina Rosso et al.previously described. Then, they were sequenced by sanger method using T7 and SP6 primers (respectively #Q5021 e #Q5011, Promega, Milan, Italy): one of these resulted wild-type and represents the only false positive sample

(4) Changes in Human Fecal Microbiota Due to Chemotherapy Analyzed by TaqMan-PCR, 454 Sequencing and PCR-DGGE FingerprintingPLoS ONEDecember 14, 2011Jutta Zwielehner, Cornelia Lassl, Berit Hippe, Angelika Pointner, Olivier J. Switzeny, Marlene Remely, Elvira Kitzweger, Reinhard Ruckser, Alexander G. Haslbergercontent of each strain. Clones CL16 and CC34 were amplified with the SP6 Promoter Primer (Promega, Cat.# Q5011) and the T7 Promoter Primer (Promega, Cat.# Q5021) and the PCR product quantified using a nanodrop machine.

(5) EFS shows biallelic methylation in uveal melanoma with poor prognosis as well as tissue-specific methylationBMC CancerDecember 1, 2011Lisa C Neumann, Andreas Weinhäusel, Stefanie Thomas, Bernhard Horsthemke, Dietmar R Lohmann, Michael ZeschnigkMini Kit (Qiagen). The cloned fragments were sequenced using the SP6 Promoter Primer (Promega, Cat.# Q5011) and aligned with the help of the BDPC web interface http://biochem.jacobs-university.de/BDPC/) [27].

Be the First to Write a Review!