Myra Liquid Handling System from Bio Molecular Systems

Product Specs
ItemMyra Liquid Handling System
CompanyBio Molecular Systems
Price Get Pricing
Catalog NumberMYRA-LHS50
Volume1 to 50 µL
Dimensions(WxDxH) 35 x 46 x 31 cm
QuantityEA
Electrical Requirements100 to 240 VAC, 50/60 Hz
Weight9 kg
Accuracy1 µL < 10%; 2 to 50 µL < 1%
CalibrationHigh precision camera
Precision1 µL < 10% CV; 2 to 50 µL < 1% CV
UV LampHigh intensity 70 mW 280 nm UV LED
ApplicationsqPCR, NGS library prep, drug discovery, and more

Specifications/Features

Position Control Closed loop, 100 micron resolution

Liquid Detection Pressure sensing

HEPA Filter 99.98% at 0.3 µm

Add to Compare List

Bio Molecular Systems

Unit 5/3 Northward Street

Upper Coomera, QLD 4209

Australia

Company Profile

Website: www.biomolecularsystems.com

(1) The relationships of viral and protozoal co-infections to Chlamydia pecorum infection and chlamydiosis outcomes in northern koalas (Phascolarctos cinereus)PLOS PathogensNovember 24, 2025Yasmine S. S. Muir, Belinda R. Wright, Andrea Casteriano, Mathew S. Crowther, Amber Gillett, Mark B. Krockenberger, Damien P. Higginsat 10-fold dilutions, ranging from 103 to 107 copies. PCR plates were prepared manually or using a Myra Liquid Handling System (Bio Molecular Systems). qPCR conditions consisted of an initial 3-min denaturation at 95°C (1 cycle)

(2) Forskolin Enhances Urokinase Plasminogen Activator Secretion and Angiogenic Activity of Xeno‐Free Cultures of Human Adipose Tissue‐Derived Stem CellsAdvanced BiologyJuly 9, 2025Maria Vittoria Giraudo, Anne Therese Lauvrud, Rebecca Wiberg, Maria Brohlin, Gustav Andersson, Paul J Kinghamused to convert 10 ng µL−1 reaction mix into complementary DNA (cDNA). RT‐qPCR was performed using Myra Liquid Handling System (Bio Molecular Systems) and Mic qPCR cycler (Bio Molecular Systems) with SsoFast EvaGreen supermix (Bio‐Rad)

(3) Early metabolic changes in the brain of Alzheimer’s disease rats are driven by GLAST+ cellsJournal of Cerebral Blood Flow & MetabolismJuly 1, 2025William J Morrey, Kelly Ceyzériat, Quentin Amossé, Aurélien M Badina, Ben Dickie, Ingo Schiessl, Stergios Tsartsalis, Philippe Millet, Hervé Boutin, Benjamin B Tournier(Thermofisher, A28140). All plates were filled using a Myra Liquid Handling System (Bio Molecular Systems, MYRA-LHS50). Each well contained 2 µL of sample cDNA and 8 µL of master mix, containing relevant primers, PowerUp™

(4) Efficient cell-free translation from diverse human cell typesJournal of Biological ChemistryJuly 1, 2025Jana Ziegelmüller, Nikolaos Kouvelas, Nino Schwaller, Priyanka Thambythurai, Alexander M. Hofer, Oliver Mühlemann, Evangelos D. KarousisGAGTCAACGGATTTGGTCG 3′; GAPDH-rev: 5′ GAGGTCAATGAAGGGGTCAT 3′) in 15 μl reactions, dispensed using the Myra Liquid Handling System (Bio Molecular Systems). qPCR was conducted using the Rotor-Gene Q (Qiagen) real-time system. Each experiment

(5) Fine-tuning GBS data with comparison of reference and mock genome approaches for advancing genomic selection in less studied farmed speciesBMC GenomicsFebruary 5, 2025Daniel Fischer, Miika Tapio, Oliver Bitz, Terhi Iso-Touru, Antti Kause, Ilma Tapiowas halved to 10 h for 96 samples and 30 h for 384 samples by normalizing DNA concentrations using Myra liquid handling system (Bio Molecular Systems, Australia), incorporating SPRIselect beads for size enrichment allowing to omit

(6) Revealing bovine schistosomiasis in Malawi: Connecting human and hybrid schistosomes within cattleOne HealthDecember 1, 2024Alexandra Juhász, Peter Makaula, Lucas J. Cunningham, Sam Jones, John Archer, David Lally, Gladys Namacha, Donales Kapira, Priscilla Chammudzi, E. James LaCourse, et al.thermocycler (Bio Molecular Systems (BMS), UK). All real-time PCR assay plates were prepared using a MYRA liquid handling system (Bio Molecular Systems (BMS), UK). Reactions were carried out in 12 μL volumes and consisted of 6 μL

(7) The influence of xeno-free culture conditions on the angiogenic and adipogenic differentiation properties of adipose tissue-derived stem cellsRegenerative TherapyOctober 10, 2024Anne Therese Lauvrud, Maria Vittoria Giraudo, Rebecca Wiberg, Mikael Wiberg, Paul J. Kingham, Maria Brohlinmanager software (Bio-Rad) as described previously [13]. Alternatively, qRT-PCR was performed using Myra Liquid Handling System (Bio Molecular Systems) and Mic qPCR cycler (Bio Molecular Systems) with the SsoFast™EvaGreen® supermix

(8) Molecular epidemiology and population genetics of Schistosoma mansoni infecting school-aged children situated along the southern shoreline of Lake Malawi, MalawiPLOS Neglected Tropical DiseasesOctober 7, 2024John Archer, Lucas J. Cunningham, Alexandra Juhász, Sam Jones, Angus M. O’Ferrall, Sarah Rollason, Bright Mainga, Priscilla Chammudzi, Donales R. Kapira, David Lally, et al.secondary species-specific duplex real-time PCR. All real-time PCR assay plates were prepared using a Myra liquid handling system (Bio Molecular Systems (BMS), UK) and all real-time PCR assays were carried out using a Magnetic Induction

(9) Strain-dependent induction of primary bile acid 7-dehydroxylation by cholic acidBMC MicrobiologyAugust 1, 2024Eduard Vico-Oton, Colin Volet, Nicolas Jacquemin, Yuan Dong, Siegfried Hapfelmeier, Karin Lederballe Meibom, Rizlan Bernier-Latmanicontrol (NRT). Reverse transcription quantitative PCR (RT-qPCR) RT-qPCRs were prepared using the Myra liquid handling system (Bio Molecular Systems, software version 1.6.26) and performed using the Magnetic induction cycler (Mic)

(10) Molecular Epidemiology and Assemblage Typing of Giardia duodenalis in School-Age Children Situated along the Southern Shoreline of Lake Malawi, MalawiThe American Journal of Tropical Medicine and HygieneSeptember 6, 2023John Archer, Lucas J. Cunningham, Alexandra Juhàsz, Sam Jones, Ffion Doull, James E. LaCourse, Bright Mainga, Peter Makaula, Sekeleghe A. Kayuni, Janelisa Musaya, et al.Molecular Systems, Upper Coomera, Australia). All real-time PCR assay plates were prepared using a Myra liquid handling system (Bio Molecular Systems, London, UK). A cycle threshold (Ct) value of ≤ 39 was deemed positive for infection

(11) Analytical sensitivity of a multiplex quantitative PCR for Toxoplasma gondii and Neospora caninumParasitology ResearchApril 1, 2023Marcus Truong, Jan Šlapeta(Table 1). All probes and primers were obtained from Integrated DNA Technologies (IDT, Australia). The Myra Liquid Handling System (Bio Molecular Systems, Australia) was used to prepare and multiplex all PCR reactions. All qPCRs were

Be the First to Write a Review!