FluoroTect GreenLys in vitro Translation Labeling System from Promega

Product Specs
ItemFluoroTect GreenLys in vitro Translation Labeling System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberL5001
Quantity40 reactions
Molecular Weight~71kDa
ApplicationsLabeling

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Phospholipid composition strongly affects the assembly of β barrel proteins into purified bacterial outer membranesNature CommunicationsJanuary 21, 2026Thushani D. Nilaweera, Nathan T. Brandes, Ian S. LaCroix, Benjamin Schwarz, Harris D. BernsteinInhibitor (New England Biolabs, catalog number M0314), 0.2 μL FluoroTect GreenLys (Promega, catalog number L5001), purified OMs (containing 2 µM BAM) or 20 mM Tris pH 8.0 as a control, and 2 µM SurA purified as described

(2) An improved model for prediction of de novo designed proteins with diverse geometriesbioRxivJune 6, 2025Benjamin Orr, Stephanie E. Crilly, Deniz Akpinaroglu, Eleanor Zhu, Michael J. Keiser, Tanja Kortemmeloaded onto tRNA; Promega FluoroTect™ GreenLys in vitro Translation Labeling System, Product Number: L5001) and fluorescence imaging (GE Typhoon FLA 9000 Imager) to detect protein expression instead of radiolabeled

(3) Post-testicular spermatozoa of a marine teleost can conduct de novo cytoplasmic and mitochondrial translationiScienceJanuary 17, 2025Castro-Arnau J, Chauvigné F, González A, Finn RN, Carrascal M, Cerdà J.ThermoFisher Scientific,15596026 FluoroTect™ GreenLys in vitro Translation Labeling System,Promega,L5001 SUPERase In Rnase inhibitor,Invitrogen; ThermoFisher Scientific,AM2696 RNasin® Plus Ribonuclease Inhibitor,Promega,N2611 TURBO

(4) CT584 Is Not a Protective Vaccine Antigen against Respiratory Chlamydial Challenge in MiceVaccines (Basel)October 3, 2024Steven Hoang-Phou, Sukumar Pal, Anatoli Slepenkin, Abisola Abisoye-Ogunniyun, Yuliang Zhang, Sean F. Gilmore, Megan L. Shelby, Feliza A. Bourguet, Mariam V. Mohagheghi, Aleksandr Noy, et al.a ThermoMixer C (Eppendorf, Hamburg, Germany). BODIPY labeled tRNA-Lys (Promega, Madison, WI, USA, #L5001) was included in the reaction at 1:200 v/v to track protein production. CT584 protein in total CFPS

(5) Evaluation in mice of cell-free produced CT584 as a Chlamydia vaccine antigenbioRxivJune 12, 2024Steven Hoang-Phou, Sukumar Pal, Anatoli Slepenkin, Abisola Abisoye-Ogunniyun, Yuliang Zhang, Sean F. Gilmore, Megan Shelby, Feliza Bourguet, Mariam Mohagheghi, Aleksandr Noy, et al.reaction mixture at 15μg/mL before transferring into the CECF device. BODIPY-FL labeled tRNA-Lys (Promega L5001) were included in initial test reactions at 1:200 v/v scale. The reaction was incubated at 30°C for

(6) Machine learning-aided design and screening of an emergent protein function in synthetic cellsNat CommunMarch 5, 2024Shunshi Kohyama, Béla P. Frohn, Leon Babl, Petra Schwillesolution at 1 ng/µL, together with 4.4% of FluoroTect GreenLys in vitro Translation Labeling System (L5001, Promega, Madison, WI, USA) and then incubated for 4 h at 37 °C. Synthesized synMinE variants were then

(7) A rapid cell-free expression and screening platform for antibody discoveryNature communicationsJuly 3, 2023Hunt AC, Vögeli B, Hassan AO, Guerrero L, Kightlinger W, Yoesep DJ, Krüger A, DeWinter M, Diamond MS, Karim AS, et al.samples. To visualize antibody assembly, proteins were labeled during CFPS with FluoroTectTM (Promega, L5001). FluoroTectTM was included in the CFPS reaction at 3.33%v/v. After protein synthesis, RNAseA (Omega

(8) Affinity microfluidics enables high-throughput protein degradation analysis in cell-free extractsCommunications BiologyOctober 28, 2022Lev Brio, Danit Wasserman, Efrat Michaely-Barbiro, Gal Barazany-Gal, Doron Gerber, Amit Tzurradiography detection or with untagged Methionine (Promega #L118A) and FluoroTect™ GreenLys (Promega #L5001). Off-chip degradation assay Degradation assays were performed in 20 μl cell extract supplemented

(9) A robust method for particulate detection of a genetic tag for 3D electron microscopyeLifeApril 27, 2021James Rae et al.oligonucleotide,PMID:19648909,,CAATAAAGTACAGAAACTGATACTTATATAGCGTT Commercial assay or kit,FluoroTect GreenLys in vitro Translation Labeling System,Promega,L5001, Commercial assay or kit,MycoAlert Mycoplasma Detection Kit,Lonza,LT07-418, "Chemical compound, drug",25%

(10) Short-chain fatty acids bind to apoptosis-associated speck-like protein to activate inflammasome complex to prevent Salmonella infectionPLoS biologySeptember 1, 2020Tsugawa H, Kabe Y, Kanai A, Sugiura Y, Hida S, Taniguchi S, Takahashi T, Matsui H, Yasukawa Z, Itou H, et al.fluorescently labeled using FluoroTect GreenLys in vitro Translation Labeling System (Promega, cat. no. L5001) according to the manufacturer’s instructions. Affinity purification using SCFA-conjugated affinity

(11) Killer cell proteases can target viral immediate-early proteins to control human cytomegalovirus infection in a noncytotoxic mannerPLoS pathogensApril 1, 2020Shan L, Li S, Meeldijk J, Blijenberg B, Hendriks A, van Boxtel KJWM, van den Berg SPH, Groves IJ, Potts M, Svrlanska A, et al.To label the produced proteins, FluoroTectTM GreenLys in vitro Translation Labeling System (Promega, L5001) was added to the reaction. Produced proteins were diluted and incubated with increasing concentrations

(12) A broad-spectrum antiviral molecule, QL47, selectively inhibits eukaryotic translationThe Journal of biological chemistryFebruary 7, 2020de Wispelaere M, Carocci M, Burri DJ, Neidermyer WJ Jr, Olson CM, Roggenbach I, Liang Y, Wang J, Whelan SPJ, Gray NS, et al.(BioTek). Reactions using the FluoroTectTM GreenLys in vitro translation labeling system (Promega, L5001) were performed using the Flexi® rabbit reticulocyte lysate system (Promega, L4540) according to the

(13) TIP30 counteracts cardiac hypertrophy and failure by inhibiting translational elongationEMBO molecular medicineOctober 1, 2019Grund A, Szaroszyk M, Korf-Klingebiel M, Malek Mohammadi M, Trogisch FA, Schrameck U, Gigina A, Tiedje C, Gaestel M, Kraft T, et al.concentration of 17 mM and incubated again for 30 min. Finally, 0.5 μl FluoroTect™ GreenLys tRNA (#L5001, Promega) was added. Beads were washed two times with GTP Binding Buffer after 30 min of incubation,

(14) Dynamic Phosphorylation of the C Terminus of Hsp70 Regulates the Mitochondrial Import of SOD2 and Redox BalanceCell reportsNovember 27, 2018Zemanovic S, Ivanov MV, Ivanova LV, Bhatnagar A, Michalkiewicz T, Teng RJ, Kumar S, Rathore R, Pritchard KA Jr, Konduri GG, et al.Coupled T/T System,Promega,Cat#L1171 FluoroTecGreenLys in vitro Translation labeling system,Promega,Cat#L5001 Pierce anti-GST coated clear strip plates,ThermoFisher,Cat#151144 Deposited Data,Deposited Data,Deposited

(15) SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidicsScientific ReportsDecember 16, 2016Dana Chen et al.reaction (TNT, Promega) with 0.5 ul of fluorescently labelled lysine (FluoroTect™ GreenLys, Promega CAT #L5001). Btd (UniProt accession no. Q24266, with zinc finger DNA-binding domain at positions 333–357, 363–385

Be the First to Write a Review!