DpnI from New England Biolabs

Product Specs
ItemDpnI
CompanyNew England Biolabs
Price $72.00 Inquire
Catalog NumberR0176S
Concentration20 u/µL
Quantity1000 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

Ga/TC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Enzymatically Controlled Release of Proteins and Peptides (ENCOREP): A Promising Alternative Secretion ApproachiScienceApril 17, 2026Daniel Ivanusic, Gregor Zipf, Josef Maier, Hubert Bernauer, Norbert Bannert,New England Biolabs,Cat# R3195 Q5 Hotstart polymerase,New England Biolabs,Cat# M0493 DpnI,New England Biolabs,Cat# R0176S PmeI,New England Biolabs,Cat# R0560 NheI-HF,New England Biolabs,Cat# R3131 T4 DNA Ligase,New England Biolabs

(2) Phage-assisted evolution of allosteric protein switchesNat CommunApril 14, 2026Nicholas T. Southern, Anna von Bachmann, Alisa Hovsepyan, Marielouise Griebl, Benedict Wolf, Nina Lemmen, Ann-Sophie Kroell, Simon Westermann, Jan Mathony, Dominik Niopek(Thermo Fisher Scientific, cat. no. EL0011). For assemblies not utilizing plasmid DNA, DpnI (New England Biolabs, cat. no. R0176S) was included to degrade methylated template DNA. Type IIs enzymes used included Esp3I (New England Biolabs

(3) Synthetic budding morphogenesis by optogenetic receptor tyrosine kinase signalingbioRxivApril 2, 2026Louis S. Prahl, Ronald Canlla, Aria Zheyuan Huang, Daniel S. Alber, Sandra L. Shefter, Sachin N. Davis, Samuel H. Grindel, Zikang Dennis Huang, Thomas R. Mumford, William Benman, et al.adjusted according to manufacturer instructions. PCR products were subsequently digested with DpnI (#R0176S, New England Biolabs) to remove template DNA and purified using a QIAquick PCR purification kit (#28104,

(4) Rapid CRISPR-Cas9 Genome Editing in S. cerevisiaebioRxivMarch 30, 2026Hosein Rostamian, Ethan W. Madden, Frank M. Kaplan, Riley Kim, Daniel G. Isom, Brian D. StrahlEngland Biolabs,M0491L High-Fidelity DNA Polymerase,New England Biolabs,M0491L DpnI,New England Biolabs,R0176S SOC medium,Invitrogen,15544034 LB broth powder,Fisher Scientific,BP97235 YPD broth powder,RPI Research

(5) CBP-IDRs regulate acetylation and gene expressionCell RepMarch 24, 2026Katie L. Gelder, Nicola A. Carruthers, Grace Gilbert, Laura J. Harrison, Brychan V. Evans, Thomas I. Evans, Sophie S. Ball, Mark Dunning, Timothy D. Craggs, Alison E. Twelvetrees, et al.Assembly reaction,NEB,E2621L NotI-HF,NEB,R3189S SbfI,NEB,R3642 T4 DNA ligase,NEB,M0202S DpnI,NEB,R0176S T4 polynucleotide kinase (PNK),NEB,EK0031 NruI-HF,NEB,R3192S PmlI,NEB,R0532S Quick Calf Intestinal

(6) A family portrait of lanmodulin selectivity for enhanced rare-earth separationsNature Chemical BiologyMarch 18, 2026Patrick Diep, Cody S. Madsen, Wonseok Choi, Ziye Dong, Christina S. Kang-Yun, Patricia F. V. Uychoco, Jeremy A. Seidel, Samuel A. Eaton, Yongqin Jiao, Joseph A. Cotruvo, et al.forward primer, 5′-ggcagcggccgcgg-3′), gel extracted the product (NEB, T1120L), DpnI-digested it (NEB, R0176S) at 37 °C for 1 h (40 units per reaction) and column purified it (Takara, 740609.250). This procedure

(7) Budding Yeast Ubiquitin Ligases Rad5 and Rad18 Bind a Novel PCNA Surface, which Is Required for their Functions in DNA-Damage ToleranceInternational Journal of Biological SciencesFebruary 26, 2026Li Fan, Ying Du, Allison Novecosky, Yu Luo, Wei Xiao(Supplementary Table S2) were used to amplify the entire plasmid. The template DNA was digested by DpnI (NEB, R0176S). The successful mutation was confirmed by sequencing the entire insert. Yeast two-hybrid assay Plasmids

(8) PFKM governs metabolic shifts throughout skeletal muscle differentiationNature MetabolismFebruary 24, 2026Melissa Campos, Steven T. Nguyen, Xiangduo Kong, Ying Yang, Richard L. Watson, Anastasia Gromova, Catherine R. Livelo, Carolina N. Franco, Julia E. Cabral, Laurence J. Seabrook, et al.was generated from WT-GFP–PFKM by using pfuUltra DNA polymerase (600385, Agilent) and Dpn1 enzyme (R0176S, New England Biolabs) and using the following PFKM primers (Integrated DNA Technologies): forward, 5′-ACATCACCCGGAAGAAGTCCGGGGAAGCGG-3′;

(9) Molecular basis for anti-jumbo phage immunity by AVAST type 5Molecular CellFebruary 19, 2026Aswin Muralidharan, Ana Rita Costa, Desi Fierlier, Daan Frits van den Berg, Halewijn van den Bossche, Adja Damba Zoumaro-Djayoon, Alicia Rodríguez-Molina, Martin Pabst, Martin Pacesa, Bruno E. Correia, et al.Instruments Inc,Cat# SI-BG01 Dithiothreitol,Sigma-Aldrich,Cat# 43815-5G DpnI,New England Biolabs,Cat# R0176S EcoRI,New England Biolabs,Cat# R0101S FastAP,Fischer Scientific,Cat# EF0651 Glycerol,Fisher Scientific,Cat#

(10) AGPAT1 is a novel Chikungunya virus receptor on human cellsJournal of VirologyFebruary 17, 2026Brohmomoy Basu, Debapriyo Sarmadhikari, Anshula Sharma, Shailendra Asthana, Manjula Kalia, Sudhanshu Vratiprimers designed for the sites are mentioned in Table S1. The PCR product was treated with DpnI (NEB, R0176S) to digest the methylated plasmid (the template), and the resultant product was PCR purified by a PCR

(11) Toehold-VISTA: a machine learning approach to decipher programmable RNA sensor-target interactionsNucleic Acids ResFebruary 16, 2026James M Robson, Alexander A Greenvector-specific primers (Supplemental Table S1). PCR was followed by DpnI digestion (New England Biolabs R0176S), column purification (New England Biolabs T1130S), and normalization to 100 ng/µl in ultrapure DNase/RNase-free

(12) Evolution of intrinsically disordered regions in vertebrate galectins for phase separationEMBO ReportsFebruary 2, 2026Yu-Hao Lin, Yu-Chen Chen, Yung-Chen Sun, Jie-rong HuangView,BioTools,TT-DNA01 Prestained Protein Molecular Weight Marker,Bioman,Prep1025 DpnI,"New England Biolabs, Inc.",R0176S Q5 High-Fidelity 2X Master Mix,"New England Biolabs, Inc.",M0492S T4 DNA Ligase,"New England Biolabs,

(13) Structural analyses and substrate profiling of PPEP-3 provide new insights into the molecular basis of Pro-Pro endopeptidase specificityiScienceJanuary 16, 2026Bart Claushuis, Fabian Wojtalla, Lisa Papenhagen, Robert A. Cordfunke, Arnoud H. de Ru, Hans C. van Leeuwen, Jeroen Corver, Paul J. Hensbergen, Ulrich BaumannXhoI,New England Biolabs,Catalog No R0146S Restriction endonuclease DpnI,New England Biolabs,Catalog No R0176S Isopropyl-β-D-thiogalactopyranoside (IPTG),Biotrend,Catalog No NB-45-00111 Kanamycine sulfate,Carl

(14) GluN2B-specific NMDAR positive allosteric modulation reverses cognitive and behavioral abnormalities in Mecp2 and Disc1 transgenic miceScience AdvancesJanuary 9, 2026Yang Ge, Tian Tian, Bolong Li, Peter Axerio-Cillies, Wenlin Chen, Xin Qin, Mudi Zhao, Qi-Cheng Sun, Jiaqi Li, Stan B. Floresco, et al.Scientific,FEREC0111 Enzymes,Enzymes,Enzymes KAPA HiFi HotStart ReadyMix,Cedarlane,KK2601 DpnI,New England Biolabs,R0176S Oligonucleotides,Oligonucleotides,Oligonucleotides Subcloning primer for GluN1L135Q: AGTATCCACCAGAGTTTCCTTCGC,This

(15) Benchmarking the PAM compatibility of Cas12a variants for high-throughput yeast genetic variant engineeringApplied and Environmental MicrobiologyDecember 23, 2025Weiyu Xie, Zhenkun Cai, Zehua Baos, 58°C for 5 s, and 68°C for 20 s) × 24 cycles, 68°C for 2 min, and held at 12°C. After DpnI (Cat. #R0176S, NEB) digestion and purification, each PCR product was transformed into DH5α Electro-Cells and spread

(16) Pre-marking chromatin with H3K4 methylation is required for accurate zygotic genome activation and developmentNat CommunDecember 19, 2025Meghana S. Oak, Marco Stock, Ana Janeva, Matthias Mezes, Antony M. Hynes-Allen, Tobias Straub, Ignasi Forné, Andreas Ettinger, Stephan Hamperl, Axel Imhof, et al.CATaDa as described previously74. Extracted genomic DNA was digested overnight at 37 °C with DpnI (NEB, R0176S), and column-purified with the QIAquick PCR Purification Kit (Qiagen, 28104). Adapters were blunt-end

(17) High-throughput in silico screen uncovers key regulators of 3D genome architecturebioRxivDecember 11, 2025Jiangshan Bai, Qingji Lyu, Jimin Tan, Robbyn Issner, Bailey Tischer, Hanqing Liu, Viraat Goel, Xinyu Ling, Bradley E. Bernstein, Aristotelis Tsirigos, et al.(NEB, M0491) in a 50 μL reaction, with an extension time of 30s/kb. Following PCR, 1 μL of DpnI (NEB, R0176S) was added and the reaction was incubated at 37 °C for 1 h to digest template plasmid, followed by heat

(18) The RNA-binding protein PRRC2B preserves 5' TOP mRNA during starvation to maintain ribosome biogenesis during nutrient recoveryNucleic Acids ResDecember 11, 2025Nadav Goldberg, Doron Bril, Miriam Eisenstein, Tsviya Olender, Alon Savidor, Shani Bialik, Shmuel Pietrokovski, Adi KimchiIII (Invitrogen, cat# 18 080 044); Restriction enzymes KpnI, EcorV, DpnI (NEB, cat# R3142S, R3195S, R0176S). Instruments used included: for fluorescence microscopy, a LSM900 confocal microscope (Zeiss); for

(19) A commensal bacterium secretes effector proteins to establish population heterogeneity in the gutCell Host & MicrobeDecember 10, 2025Anna P. Zagieboylo, Ran Mo, Bentley Lim, Andrew L. Goodman,New England Biolabs,Cat#R3133S XbaI-HF,New England Biolabs,Cat#R0145S DpnI-HF,New England Biolabs,Cat#R0176S NEBuilder HiFi DNA Assembly Master Mix,New England Biolabs,Cat#E2621 Hexameric random primers,Invitrogen,Cat#N8080127 SuperScript™ II Reverse Transcriptase

(20) Functional Mapping of Epigenomic Regulators Uncovers Coordinated Tumor Suppression by the HBO1 and MLL1 ComplexesCancer DiscoveryDecember 2, 2025Yuning J. Tang, Haiqing Xu, Nicholas W. Hughes, Paloma Ruiz, Samuel H. Kim, Emily G. Shuldiner, Steven S. Lopez, Jess D. Hebert, Saswati Karmakar, Laura Andrejka, et al.AACTATATAAAGCTAAGAATAGAAAAAATTTTACAGTTATGGT 3’. The PCR product was then treated with DpnI restriction endonuclease (NEB, R0176S) to digest the original vector thereby reducing background bacterial colonies. This linearized backbone

Be the First to Write a Review!

DpnI

DpnI from New England Biolabs

Sequence

New England Biolabs

Citations (449)

Reviews

DpnI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map