Single-Use HB101 Competent Cells, >10(8)cfu/ug from Promega

Product Specs
ItemSingle-Use HB101 Competent Cells, >10(8)cfu/ug
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberL2015
Quantity1ml
Cell Type (standardized)Competent Cells
SpeciesEscherichia

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Distinct associations of pioneer factor Ascl1-E12a with nucleosomes drive changes in cell fateMolecular CellJuly 2, 2026Bing-Rui Zhou, Edgar Luzete-Monteiro, Jingchao Zhang, Naomi Takenaka, Hsin-Yao Tang, Meilin Fernandez Fernandez Garcia, Mariel Coradin, Megan Frederick, Greg Donahue, Benjamin Garcia, et al.One Shot™ TOP10 Chemically Competent E. coli,Invitrogen,Cat# C404010 E. coli: HB101 Competent Cells,Promega,Cat# L2015 Lenti-V5-Ascl1(WT)-P2A-E12a-flag,This paper,N/A Lenti-V5-Ascl1(AAA)-P2A-E12a-flag,This paper,N/A Lenti-V5-Ascl1(allRs)-P2A-E12a-flag,This

(2) Nitrogen metabolism profiling reveals cell state-specific pyrimidine synthesis pathway choiceNature MetabolismApril 29, 2026Milan R. Savani, Bingbing Li, Bailey C. Smith, Wen Gu, Yi Xiao, Gerard Baquer, Tracey Shipman, Skyler S. Oken, Namya Manoj, Lauren G. Zacharias, et al.(Thermo Fisher, 11789100). The resultant product was transformed into HB101 Competent Cells (Promega, L2015). N-terminal Flag and HA tags followed by the linker sequence AGCGGCCGCTCGTCTGCGTGCTTGCCCTGTCTCAGCTCCGACCCG

(3) The SLC1A1/EAAT3 dicarboxylic amino acid transporter is an epigenetically dysregulated nutrient carrier that sustains oncogenic metabolic programsNature CommunicationsNovember 14, 2025Treg Grubb, Pooneh Koochaki, Sayed Matar, Fatme Ghandour, Marc Machaalani, Eddy Saad, Cerise Tang, Eduard Reznik, Jesminara Khatun, Carleigh Salem, et al.provided in Supplementary Data 2. The clones were transformed and amplified in HB101 E. coli (Promega L2015), quantified using the nanodrop, and combined into an equimolar pool. The CRISPR/Cas9 constructs to

(4) An Optimized Protocol for Human Direct Cardiac ReprogrammingSTAR ProtocolsJuly 31, 2020Tiffany A. Garbutt, Yang Zhou, Benjamin Keepers, Jiandong Liu, Li Qianand Virus Strains,Bacterial and Virus Strains,Bacterial and Virus Strains ,, E.coli: HB101,Promega,L2015 E.coli: XL10-Gold Ultracompetent cells,Agilent,200315 ,, Biological Samples,Biological Samples,Biological

(5) Construction of Antisense RNA-mediated Gene Knock-down Strains in the Cyanobacterium Anabaena sp. PCC 7120BIO-PROTOCOLFebruary 20, 2020Amit Srivastava, Anand Ballal, Karl Forchhammer, Anil Kumar TripathimB-) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl1 rpsL20 (SmR) glnV44 λ- (Promega, catalog number: L2015) 8. E. coli HB101-R2: Donor strain carrying pRL623 (encoding methylases) and pRL443 (conjugal plasmid)

(6) De novo pyrimidine synthesis is a targetable vulnerability in IDH mutant gliomaCancer cellJanuary 1, 0001"Shi DD, Savani MR, Levitt MM, Wang AC, Endress JE, Bird CE, Buehler J, Stopka SA, Regan MS, Lin YF, et al."by Vigene Biosciences",https://www.vigenebio.com/aav-packaging/ HB101 Competent Cells,Promega,Cat# L2015 ,, Biological samples,, ,, UTSW6577 glioma specimen,Abdullah et al. (2022),N/A UTSW1382 glioma

Be the First to Write a Review!