GoTaq G2 DNA Polymerase M7848 from Promega

Product Specs
ItemGoTaq G2 DNA Polymerase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7848
Size2,500u

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Exome sequencing enables molecular diagnosis in 10% of early-onset or familial systemic lupus erythematosus casesEBioMedicineApril 1, 2026Maud Tusseau, Samira Khaldi-Plassart, Audrey Labalme, Anne-Laure Mathieu, Quentin Riller, Corentin Molitor, Thomas Simonet, Sebastien Viel, Christine Gaboriaud, Nicole Thielens, et al.manufacturer's protocol. cDNA amplification was subsequently carried out using GoTaq G2 DNA Polymerase (Promega, M7841). IKZF3 expression The plasmid pTwist CMV, with either wild-type or mutated IKZF3 (NM_001257414) cDNA

(2) The microcephaly-associated protein YIPF5 differentially regulates ER exportiScienceFebruary 20, 2026Francesca Bruno, Mihaela Anitei, Domenico Di Fraia, William Durso, Therese Dau, Emilio Cirri, Mara Sannai, Christina Valkova, Julija Maldutyte, Elizabeth A. Miller, et al.inhibitor cocktail,Roche,Cat#5056489001 CHAPSO,Carl ROTH,Cat#82473-24-3 GoTaqG2 polymerase,Promega,Cat#M7841 NEBuilder® HiFi DNA Assembly Master Mix,New England Biolabs,Cat#E2621 Dulbecco’s Modified Eagle Medium

(3) De novo cysteine biosynthesis in Pseudomonas aeruginosa: Characterization of the two main cysteine synthase isoformsiScienceJanuary 16, 2026Rebecca Martedì, Jole Maria Lucia D’Angelo, Giulia Sassi, Marialaura Marchetti, Sarah Hijazi, Riccardo Percudani, Stefano Bettati, Barbara Campanini, Emanuela Frangipani"T4 DNA Ligase, 100u",Promega Italia Srl,Cat# M1801 "GoTaq(R) G2 DNA Polymerase, 100u",Promega Italia Srl,Cat# M7841 ,, Critical commercial assays,Critical commercial assays,Critical commercial assays ,, "Wizard(R)

(4) Rethinking genomics of facioscapulohumeral muscular dystrophy in the telomere-to-telomere era: pitfalls in the hidden landscape of D4Z4 repeatsEuropean Journal of Human GeneticsJanuary 14, 2026Valentina Salsi, Francesca Losi, Sara Pini, Matteo Chiara, Rossella Tuplersemi-quantitative PCR was performed with 50 ng of genomic DNA using GoTaq® G2 DNA Polymerase (Promega, cat. #M7841) under standard cycling conditions, with annealing temperatures optimized around 60°C. For targets producing

(5) Unbiased and comprehensive identification of virus-derived circular RNAs in a large range of viral species and familiesPLOS PathogensSeptember 11, 2025Alexis S. Chasseur, Maxime Bellefroid, Mathilde Galais, Meijiao Gong, Pierre Lombard, Sarah Mathieu, Amandine Pecquet, Estelle Plant, Camille Ponsard, Laure Vreux, et al.control was produced. The PCRs were carried out using primers detailed in S1 Table and the GoTaq G2 kit (M7841 – Promega) or the Q5 taq polymerase (M0491L – New England Biolabs). The cycles were adapted to the manufacturers’

(6) A simple and rapid shaking-based assay to genotype live, early developmental stage zebrafish embryosLaboratory AnimalsAugust 14, 2025Rima Siauciuinate, Christelle Etard, Almut Koehler, Odelia Pisanty, Miriam Otto, Thomas Dickmeis, Olivier Kassel, Yoav Gothilf, Nicholas S Foulkes, Daniela ValloneRoth ref. 9127.2);0.025 mg/ml PK;PCR reactions:GoTaq Polymerase and GoTaq Green buffer (Promega, ref. M7845);dNTPs 10 mM Mix (Promega, ref. U1511);PCR primers (Sigma-Aldrich);DNA-ladder 100 bp (New England BioLabs,

(7) Establishing a pediatric solid tumor PDX biobank for precision oncology researchCancer Biol TherAugust 13, 2025Larissa Akemi Kido, Milena Rodrigues Marusco, Ellen Aparecida da Silva, Laís Do Carmo, Ana Beatriz Teodoro Borges, Felipe Luz Torres Silva, Juliana Silveira Ruas, Dieila Giomo de Lima, Larissa de Abreu Fernandes, Camila Maia Martin Daiggi, et al.translocation analysis. PCR reactions were performed using GoTaq G2 polymerase (Promega™, Madison, WI, USA, Cat#M7841), specific primers for target translocations and optimized thermal cycling conditions. The translocations

(8) A chimeric Mla-Pqi lipid transport system is required for Brucella abortus survival in macrophagesThe EMBO JournalAugust 13, 2025Adélie Lannoy, Alexi Ronneau, Miguel Fernández-García, Marc Dieu, Patricia Renard, Antonia García Fernández, Raquel Condez-Alvarez, Xavier De Bolleacid,ThermoFisher,B25096 gentamicin,Sigma,G1397 ampicillin,Sigma,A9518 Q5® High-Fidelity DNA Polymerase,New England Biolabs,A9518 GoTaq® DNA polymerase,Promega,M7848 T4 DNA ligase,Invitrogen,100004917 EcoRV,New England Biolabs,R3195S Sodium deoxycholate,VWR,0613-50

(9) Mitochondrial dynamics and quality control regulate proteostasis in neuronal ischemia-reperfusionAutophagyJuly 1, 2025Fogo GM, Raghunayakula S, Emaus KJ, Torres Torres FJ, Shangguan G, Wider JM, Hüttemann M, Sanderson TH.Reaction Buffer (Promega, M791A), dNTP mix (Promega, U1515), and GoTaq G2 DNA polymerase (Promega, M7848). PCR products were run on 1.5% agarose gels with 1X GelRed Nucleic Acid Stain (MilliporeSigma, SCT123)

(10) Physiological role and mechanisms of action for a long noncoding haplotype regionCell ReportsJune 24, 2025Hong Xue, Manoj K. Mishra, Yong Liu, Pengyuan Liu, Michael Grzybowski, Rajan Pandey, Kristie Usa, Mark A. Vanden Avond, Niharika Bala, Abdel A. Alli, et al.Triton X-100 Surfact-Amps Detergent Solution,Thermo Scientific,Cat# 85111 Tween 20,Bio-Rad,Cat# 1706531 GoTaq G2 DNA Polymerase,Promega,Cat# M7841 Q5 Hi-fidelity DNA polymerase,NEB,Cat# M0491S 2.5% normal horse serum,Vector Labs,Cat# S-2012-50 Vectashield

(11) Senescence and inflammation are unintended adverse consequences of CRISPR-Cas9/AAV6-mediated gene editing in hematopoietic stem cellsCell Rep MedJune 17, 2025Anastasia Conti, Kety Giannetti, Federico Midena, Stefano Beretta, Nicolò Gualandi, Rosaria De Marco, Edoardo Carsana, Angelica Varesi, Teresa Tavella, Laura Alessandrini, et al.,New England Biolabs,Cat#M0302L TaqMan PreAmp Master Mix 2X,Thermo Fisher,Cat#4488593 GoTaq G2 DNA Polymerase,Promega,Cat# M7841 MinElute PCR Purification kit,QIAGEN,Cat#28004 QuickExtract DNA Extraction Solution,Lucigen,Cat#QE09050 DNeasy

(12) Functional Characterization of LTR12C as Regulators of Germ-Cell-Associated TA-p63 in U87-MG and T98-G In Vitro ModelsCellsJune 5, 2025Lucia Meola, Sohum Rajesh Shetty, Angelo Peschiaroli, Claudio Sette, Camilla Bernardini20 μL was amplified by conventional polymerase chain reaction (PCR) using GoTaq polymerase (Promega, M7841, Madison, WI, USA) and analyzed by agarose gel electrophoresis. Amplified DNA was isolated from the

(13) Perinatal death in pig models of hypertrophic cardiomyopathy carrying sarcomere pathogenic variantsJournal of Molecular and Cellular Cardiology PlusJune 1, 2025Tatiana Flisikowska, Björn Petersen, Giulia Mearini, Daniela Huber, Mayuko Kurome, Melanie Stoff, Saskia Schlossarek, Andrea Lucas-Hahn, Eckhard Wolf, Judith Montag, et al.5’-GATGCAGAGCTGCTCAAAGCTGTT-3′ resulting in an amplicon of 492 bp. PCRs were carried out using GoTaq polymerase (Promega, M7841) with the following thermal cycling parameters: 2 min, 95 °C then 45 cycles of: 30 s, 95 °C; 30 s, 60

(14) Mitochondria regulate MR1 protein expression and produce self-metabolites that activate MR1-restricted T cellsProc Natl Acad Sci U S AMay 20, 2025Gennaro Prota, Giuliano Berloffa, Wael Awad, Alessandro Vacchini, Andrew Chancellor, Verena Schaefer, Daniel Constantin, Dene R. Littler, Rodrigo Colombo, Vladimir Nosi, et al.ND5-, and GAPDH-specific primer pairs were used in PCRs with GoTaq G2 DNA polymerase (Promega, Cat#M7845). Clones were generated by limiting dilution and expansion. PCR confirmed the lack of mitochondrial

(15) Capsular Polysaccharide Restrains Type VI Secretion in Acinetobacter baumanniiElifeJanuary 3, 2025Nicolas Flaugnatti, Loriane Bader, Mary Croisier-Coeytaux, Melanie Blokesch,New England Biolabs,M0491L,Polymerase for PCR Commercial kit or assay,GoTaq G2 DNA polymerase,Promega,M7848,Polymerase for PCR Recombinant DNA reagent,Plasmids,This study,Plasmids,See Supplementary file 1 for

(16) Loop-extrusion-mediated plasmid DNA cleavage by the bacterial SMC Wadjet complexMolecular CellJanuary 2, 2025Biswajit Pradhan, Amar Deep, Jessica König, Martin Dieter Baaske, Kevin D. Corbett, Eugene Kimhandles were made using a PCR on pBluescript SK+ (Stratagene) with GoTaq G2 DNA polymerase (Promega, M7845). The PCR was done using biotinylated primers primer CD21 (GACCGAGATAGGGTTGAGTG) and CD22 (CAGGGTCGGAACAGGAGAGC),

(17) Methods for investigating STAT3 regulation of lysosomal function in mammary epithelial cellsJournal of Mammary Gland Biology and NeoplasiaDecember 1, 2024Bethan Lloyd-Lewis, Michael E. D’Angelo, Neve B. Prowting, Bethan E. Wiseman, Timothy J. Sargeant, Christine J. Watsonequivalent).Cryovials.Genomic DNA extraction kit (e.g. 69504, QIAGEN).Thermostable DNA polymerase (e.g. M7841, Promega).PCR clean-up kit (e.g. 28106, QIAGEN).Primary and secondary antibodies to assess STAT3 knockdown

(18) Heterochromatin-dependent transcription links the PRC2 complex to small RNA-mediated DNA eliminationEMBO ReportsNovember 29, 2024Therese Solberg, Chundi Wang, Ryuma Matsubara, Zhiwei Wen, Mariusz Nowackiother reagents" Q5 high-fidelity DNA polymerase,NEB,Cat# M0491L GoTaq G2 DNA polymerase,Promega,Cat# M7848 RadPrime DNA Labeling System,Invitrogen,Cat# 18428011 Wheat grass powder,"Pines International, Lawrence,

(19) Outbreak of Western Equine Encephalitis Virus Infection Associated with Neurological Disease in Horses Following a Nearly 40-Year Intermission Period in ArgentinaVirusesOctober 10, 2024María Aldana Vissani, Florencia Alamos, María Silvia Tordoya, Leonardo Minatel, Juan Manuel Schammas, María José Dus Santos, Karina Trono, María E. Barrandeguy, Udeni B. R. Balasuriya, Mariano CarossinoPCR. The 25 μL reaction contained 5 μL of PCR Green Buffer with magnesium chloride (Promega, Cat N° M7845, Madison, WI, USA), 1 μL of 5 mM dNTP, 0.75 μL of 50 mM magnesium chloride, 0.25 μL of GoTaq DNA polymerase

(20) Ablation of PC1/3 in POMC-Expressing Tissues but Not in Immune Cells Induces Sepsis HypersensitivityJournal of the Endocrine SocietySeptember 26, 2024Moeller J, Meier DT.1.25 μL was used for the polymerase chain reaction (PCR) reaction employing GoTaq G2 DNA Polymerase (M7845, Promega, Dübendorf, Switzerland) with primers (Microsynth, Balgach, Switzerland) on a Biometra TRIO

Be the First to Write a Review!

GoTaq G2 DNA Polymerase

GoTaq G2 DNA Polymerase from Promega

Description

Promega

Citations (72)

Reviews

GoTaq G2 DNA Polymerase from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map