ProtoScript II Reverse Transcriptase M0368L from New England Biolabs

Product Specs
ItemProtoScript II Reverse Transcriptase
CompanyNew England Biolabs
Price $198.00 Inquire
Catalog NumberM0368L
Size10000 units
ApplicationsDNA Analysis
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(101) Protocol to colonize gnotobiotic mice in early life and assess the impact on early life immune programmingSTAR protocolsDecember 16, 2022Lynn MA, Ryan FJ, Tee YC, Lynn DJ.(https://www.nebiolabs.com.au/protocols/2016/04/26/first-strand-cdna-synthesis-standard-protocol-neb-m0368).a.Mix 1 μg of RNA with buffer, Oligo dTs, dNTPs, as per manufacturer’s instructions (Table 4).b.Denature

(102) Tracking cryptic SARS-CoV-2 lineages detected in NYC wastewaterNature CommunicationsDecember 1, 2022Davida S. Smyth, Monica Trujillo, Devon A. Gregory, Kristen Cheung, Anna Gao, Maddie Graham, Yue Guan, Caitlyn Guldenpfennig, Irene Hoxie, Sherin Kannoly, et al.wastewater was used to generate cDNA using ProtoScript® II Reverse Transcriptase kit (New England Biolabs, M0368S). The RNA was incubated with an RBD specific primer (ccagatgattttacaggctgcg, Genewiz) and dNTPs (0.5

(103) Aryl hydrocarbon receptor and Krüppel like factor 10 mediate a transcriptional axis modulating immune homeostasis in mosquitoesScientific ReportsDecember 1, 2022Aditi Kulkarni, Ashmita Pandey, Patrick Trainor, Samantha Carlisle, Wanqin Yu, Phanidhar Kukutla, Jiannong Xu(Invitrogen, AM1906). The cDNA synthesis was carried out using NEB ProtoScript II Reverse Transcriptase (NEB, M0368S). The cDNA was used as a template for RT-PCR, to determine transcript abundance for various genes. The

(104) A versatile active learning workflow for optimization of genetic and metabolic networksNature CommunicationsDecember 1, 2022Amir Pandi et al.(iTaq Universal SYBR Green Supermix Bio-Rad #1725120) when converted to cDNA by ProtoScript® II Reverse Transcriptase (NEB #M0368) using the standard protocol and random hexamer primers (ThermoFisher #SO142), but not in control reactions

(105) Implementing wastewater surveillance for SARS‐CoV‐2 on a university campus: Lessons learnedWater Environment ResearchNovember 13, 2022Brian A. Wartell, Camila Proano, Lena Bakalian, Devrim Kaya, Kristen Croft, Michael McCreary, Naomi Lichtenstein, Victoria Miske, Patricia Arcellana, Jessica Boyer, et al.(Zymo Research, Irvine, CA, USA) and was converted to cDNA according to the methods outlined in the NEB #M0368 Standard Protocol (New England Biolabs, 2020). It was then processed and analyzed by RT‐qPCR via the

(106) Genetic context effects can override canonical cis regulatory elements in Escherichia coliNucleic Acids ResearchOctober 14, 2022Scott A Scholz, Chase D Lindeboom, Peter L FreddolinoReverse transcription for RT-qPCR was performed using NEB Protoscript II Reverse Transcriptase (product # M0368, New England Biolabs, Ipswich, MA). qPCR then used the BioRad iTaq Universal SYBR Green Supermix (product

(107) Rolling circle reverse transcription enables high fidelity nanopore sequencing of small RNAPLOS ONEOctober 10, 2022Sean Maguire, Shengxi Guan(AMV; NEB M0277), Moloney Murine Leukemia Virus RT (MMLV; NEB M0253), ProtoScript II RT (PSII; NEB M0368), SuperScript IV RT (SSIV; Thermofisher; Waltham, MA), WarmStart RTx (RTx; NEB M0380), Thermostable

(108) A custom library construction method for super-resolution ribosome profiling in ArabidopsisPlant MethodsOctober 4, 2022Hsin-Yen Larry Wu, Polly Yingshan HsuOligo Clean & Concentrator kit. Next, reverse transcription was carried out with ProtoScript II (NEB M0368L) and a reverse transcription primer whose sequence at the 3’ end was complementary to the linker. The

(109) The transcription factor Bach2 negatively regulates murine natural killer cell maturation and functioneLifeOctober 3, 2022Li S, Bern MD, Miao B, Fan C, Xing X, Inoue T, Piersma SJ, Wang T, Colonna M, Kurosaki T, et al.GSE83978 and GSE77857. For qPCR, cDNA was synthesized by ProtoScript II Reverse Transcriptase (NEB, M0368S, Ipswich). Pre-designed primers for indicated genes were obtained from IDT. Quantitative real-time PCR

(110) Chaperone requirements for de novo folding of Saccharomyces cerevisiae septinsMolecular biology of the cellOctober 1, 2022Hassell D, Denney A, Singer E, Benson A, Roth A, Ceglowski J, Steingesser M, McMurray M.(≤500 ng) was used to generate cDNA using Protoscript II Reverse Transcriptase (New England Biolabs #M0368) and the standard first-strand cDNA synthesis protocol. Reverse transcriptase (RT)-PCR with OneTaq (New England Biolabs

(111) Development of a ribosome profiling protocol to study translation in Kluyveromyces marxianusFEMS Yeast ResearchSeptember 12, 2022Darren A Fenton, Stephen J Kiniry, Martina M Yordanova, Pavel V Baranov, John P MorrisseyT4 RNA ligase 2, truncated K227Q (#M0351L, NEB). The footprints were reverse transcribed using ProtoScript II (#M0368L, NEB). cDNA products were circularized using CircLigase II (#CL9025K, Epicentre/Lucigen). The major

(112) Microtubule integrity regulates budding yeast RAM pathway gene expressionFrontiers in Cell and Developmental BiologySeptember 12, 2022Cameron Howard Lee, Sue Bigginsoligo dT primer (Thermo Fisher Scientific #FERSO132) and Protoscript II (200 μ/μl; New England Biolabs #M0368L) in a 20 μl reaction for 30 min at 50°C. Samples were diluted to 120 μl with dH2O prior to qRT-PCR that

(113) Multifarious Translational Regulation during Replicative Aging in YeastJournal of FungiSeptember 5, 2022Tianyu Zhao, Asaka Chida, Yuichi Shichino, Dongwoo Choi, Masaki Mizunuma, Shintaro Iwasaki, Yoshikazu OhyaJapan), 5 mM MgCl2 (Nacalai Tesque, Cat. # 20942-34), 1 mM dithiothreitol (New England Biolabs, Cat. # M0368L, New England Biolabs Inc., Ipswich, MA, USA), 100 µg/mL cycloheximide (Sigma-Aldrich, Cat. # C4859-1ML),

(114) Integrated analysis of small RNAs, transcriptome and degradome sequencing reveal the drought stress network in Agropyron mongolicum KengFrontiers in Plant ScienceAugust 18, 2022Bobo Fan et al.Indianapolis, IN, United States). The reverse transcription was amplified with reverse transcriptase (m0368; New England Biolabs, Ipswich, MA, United States). The degradation group sequencing library was built

(115) Gammaherpesvirus-mediated repression reveals EWSR1 to be a negative regulator of B cell responsesProceedings of the National Academy of Sciences of the United States of AmericaAugust 9, 2022Wang Y, Feswick A, Apostolou V, Petkov PM, Moser EK, Tibbetts SA.reverse-transcribed into complementary DNA by using ProtoScript II reverse transcriptase (New England Biolabs, M0368S) with random primer mix (New England Biolabs, S1330S). The qPCR was performed in triplicate on the Bio-Rad

(116) Mechanistic basis for maintenance of CHG DNA methylation in plantsNature communicationsJuly 5, 2022Fang J, Jiang J, Leichter SM, Liu J, Biswal M, Khudaverdyan N, Zhong X, Song J.synthesized from 2 μg of the extracted total RNA using anchored oligodT18VN and ProtoScript II (NEB, M0368) reverse transcriptase. For McrBC-qPCR, plant genomic DNA was extracted using the cetyltrimethylammonium

(117) CRISPR-Cas13a cascade-based viral RNA assay for detecting SARS-CoV-2 and its mutations in clinical samplesSensors and Actuators B: ChemicalJuly 1, 2022Yuxi Wang et al.procured from Thermo Fisher Scientific (Waltham, USA). ProtoScriptⅡ Reverse Transcriptase (200 U/μL, #M0368S), dNTPs (#N0447S) and rNTPs mixes (#N0466S) were procured from NEB (Ipswich, USA). Hifair® Ⅲ 1st Strand

(118) Persistent CAD activity in memory CD8(+) T cells supports rRNA synthesis and ribosomal biogenesis required at rechallengeScience immunologyMay 27, 2022Claiborne MD, Sengupta S, Zhao L, Arwood ML, Sun IM, Wen J, Thompson EA, Mitchell-Flack M, Laiho M, Powell JD.15596018). RNA was converted to cDNA using the ProtoScript II Reverse Transcriptase (New England BioLabs, M0368). qRT-PCR was performed with PowerSYBR® Green PCR Master Mix (ThermoFisher). 5’ ETS pre-rRNA, Ifng,

(119) Nationwide Trends in COVID-19 Cases and SARS-CoV-2 RNA Wastewater Concentrations in the United StatesACS ES&T WaterMay 3, 2022Claire Duvallet et al.quantify the RNA. First, 10 μL of RNA samples was first reverse transcribed in a 25 μL reaction (NEB M0368), and then 2 μL per reaction of cDNA was assayed by qPCR (ThermoFisher 4444557) using a SARS-CoV-2 nucleocapsid

(120) Ageing induces tissue‐specific transcriptomic changes in Caenorhabditis elegansThe EMBO JournalApril 19, 2022Xueqing Wang, Quanlong Jiang, Yuanyuan Song, Zhidong He, Hongdao Zhang, Mengjiao Song, Xiaona Zhang, Yumin Dai, Oezlem Karalay, Christoph Dieterich, et al.Protease from Streptomyces griseus,Sigma‐Aldrich,Cat# P6911 ProtoScript II Reverse Transcriptase,New England Biolabs,Cat # M0368L Q5® High‐Fidelity DNA Polymerase,New England Biolabs,Cat# M0491L RiboLock RNase Inhibitor,Thermo Fisher,Cat

Be the First to Write a Review!

ProtoScript II Reverse Transcriptase

ProtoScript II Reverse Transcriptase from New England Biolabs

New England Biolabs

Citations (208)

Reviews

ProtoScript II Reverse Transcriptase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map