Q5 Hot Start High-Fidelity 2X Master Mix M0494L from New England Biolabs

Product Specs
ItemQ5 Hot Start High-Fidelity 2X Master Mix
CompanyNew England Biolabs
Price $928.00 Inquire
Catalog NumberM0494L
Size500 reactions
ApplicationsDNA Analysis
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Virulence attenuation in ST11-K64 Klebsiella pneumoniae explains its divergent clinical manifestation from ST23-K1VirulenceDecember 31, 2026Shujing Li, Ying Zhang, Qian Zeng, Lilan Zheng, Jing Yan, Yong Wang, Yun Liu, Lianhua Yu, Yi Li, Meng Li, et al.pACYC-iucA and pACYC-rmpA2 were constructed using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, M0494), following the manufacturer’s recommended protocol. Additionally, the pACYC184 plasmid was electrotransferred

(2) Systemically delivered mRNA-LNPs transfect primary and secondary liver tumorsMolecular Therapy Nucleic AcidsSeptember 8, 2026Laura J. Leighton, Yee Jing Gee, Sachithrani U. Madugalle, Maria Victorova, Nissa L. Carrodus, Kim R. Bridle, Sidney A. Howell, Xiaowen Liang, Gregory C. Miller, Chris L.D. McMillan, et al.(Integrated DNA Technologies, Singapore). DNA was amplified using 2X Q5 PCR master mix (New England Biolabs M0494L) with a forward primer containing a T7 promoter and a reverse primer encoding a 126-nt poly(A) tail.

(3) A tailored in vivo CRISPR screen identifies BAP1 as a potent tumor suppressor of sarcomaJCI InsightAugust 24, 2026Jianguo Huang, Xingliang Liu, Warren Floyd, William Haugh, Zhaoyu Sun, Melissa J. Kasiewicz, Yaping Wu, Brian Piening, John T. Welle, Wesley K. Rosales, et al.performed with specific primer (Supplemental Table 4) using Q5 HiFi DNA polymerase (New England Biolabs, M0494) (11). PCR was sent to Azenta for Sanger sequencing or next-generation sequencing. Western blot analysis. NIH

(4) Efficient and Fast Site-Directed Mutagenesis via Partially or Completely Overlapping Primer PairsBio ProtocAugust 20, 2026Paulina Varela-Castillo, Arezousadat Razavi, Changsheng Zhao, Martin M. Geng, Amitis Nour, Xiang-Jiao Yangcatalog number: 12368010) or Q5® High-Fidelity DNA Polymerase (New England Biolabs, catalog number: M0494S) Note: Notably, while we have used these two enzymes extensively, we have not tested their related preparations,

(5) FHL3 Regulates Vascular Smooth Muscle Cell Phenotypic Switching Through the MRTFB-SRF Signaling AxisCellsAugust 17, 2026Xiaoxin Huang, Heming Zhang, Yanhong Zhang, Charles U. Solomon, David G. McVey, Shu Yegenomic DNA using Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA; M0494L). Polymerase chain reaction (PCR) primers were designed according to the protocol reported by Joung

(6) Profiling Protein‐Peptide Interactions by Yeast Surface DisplayCurr ProtocAugust 8, 2026Joseph D. Hurley, Andrew C. Kruseplates containing ampicillinQ5 Hot Start High‐Fidelity 2× Master Mix (New England Biolabs, cat. no. M0494S) or equivalent high‐fidelity PCR master mixPCR primers flanking peptide region (e.g., Insert F1 and

(7) BASELINE: a CRISPR base editing platform for mammalian-scale single-cell lineage tracingNucleic Acids ResAugust 4, 2026Evan Winter, Francesco Emiliani, Aidan Cook, Asma Abderrahim, Aaron McKennaamplification reactions were performed using Q5 Hot Start 2× Master Mix (New England Biolabs, Cat. No. M0494L) with SYBR™ Green I Nucleic Acid Gel Stain (Thermo Fisher Scientific, Cat. No. S7563) on a CFX Connect

(8) A self-complementary recombinant adeno-associated virus vector coding for an anchorless prion protein carrying the G127V mutation extends survival in a rodent prion disease modelPLoS PathogAugust 4, 2026Thomas Zerbes, Claire Verkuyl, Cunjie Zhang, Sophie Grunnesjoe, Shehab Eid, Hamza Arshad, Wenda Zhao, Zahra Nasser, Teaghan O'Shea, Ari Bel, et al.reaction, 50 ng of gDNA was amplified with Q5 Hot Start High-Fidelity 2X Master Mix (catalog number M0494S, New England Biolabs) and forward and reverse primers (final concentration 500 nM) that map to gDNA

(9) A comprehensive map of missense trafficking variants in rhodopsin and their response to pharmacologic correctionSci AdvJuly 31, 2026Kannan V. Manian, Connor H. Ludwig, Yan Zhao, Nathan S. Abell, Robert Warneford-Thomson, Henry Chan, Zachary O. Casey, Xiaoping Yang, David E. Root, Matthew L. Albert, et al.either side of the ORF region and was performed using Q5 Hot Start High-Fidelity 2X Master Mix (NEB, M0494S) using the program: 95°C for 30 seconds, 98°C for 10 seconds, 69°C for 30 seconds, 72°C for 2.5 minutes

(10) Genomic and Epidemiological Characterization of DENV-1 and DENV-2 Co-Circulation During the 2023-2024 Dengue Epidemic in Espírito Santo, BrazilJ Med VirolJuly 30, 2026Nicolli Ribeiro de Jesus, Caio Santos de Souza, Mariene R. Amorim, João Paulo Cola, Raquel Gomes Catozo, Bruno Luiz M. Guedes, Bruna Caetano Pimenta, Julia Sthefany Nunes Zordan, Yasmim Barcellos Madeira Rosa, Henrique Tamanini Silva Moschen, et al.DENV‐1 and DENV‐2 previously described [18], and the Q5 Hot Start High‐Fidelity 2x MM kit (NEB, Cat. M0494). Samples were normalized, and the library was assembled using NEBNext Ultra II End repair/dA tailing

(11) The Microbiome of Nurdles: Life on the Primary Microplastics of the Texas Gulf CoastMicroPubl BiolJuly 29, 2026Vibha Annaswamy, Michelle Mikesh, Kasia Dinkeloowas completed with 10 ng template DNA, using Hot-Start Q5 2X Master Mix (New England Biolabs, CAT# M0494S). Initial denaturation at 98°C was followed by 25 cycles of 20 s at 98°C, 30 s at 55°C, 30 s at 72°C,

(12) An optimized CRISPR/Cas9-based genome editing platform enhances bacteriocin production in Lactiplantibacillus plantarumJ Biol EngJuly 29, 2026Rajat Anand, Rudolf Lütticken, Laura De Laporte, Andreas Herrmann, Elisabeth Heinekits High-fidelity PCR amplification was performed using Q5® Hot Start High-Fidelity 2X Master Mix (NEB, Cat no. M0494S), and colony PCR was performed using OneTaq® Hot Start 2X Master Mix (NEB, Cat no. M0484S). PCR and

(13) Single-cell chromatin state transitions during epigenetic memory formationSci AdvJuly 24, 2026Taihei Fujimori, Abby R. Thurm, Simon Gaudin, Carolina Rios-Martinez, Benjamin R. Doughty, Michaela M. Hinks, Joydeb Sinha, Derek Le, Antonina Hafner, William J. Greenleaf, et al.from pLB37_PB_pGK-H2B-mIFP-T2A-rTetR-HDAC4-zeo (Addgene, #179440) using Q5 hot start polymerase (NEB, M0494S). A lentiviral backbone containing pEF1alpha-driven expression of 3xFLAG-tagged rTetR(SE-G72P) was then

(14) KOLF2.1J iTF-Microglia: A standardized platform to study microglial transcriptional regulatory networks in CNS diseaseiScienceJuly 17, 2026Brianne B. Rogers, Ashlyn G. Anderson, Ivan Rodriguez-Nunez, Samuel C. Bartley, S. Quinn Johnston, Jared W. Taylor, Sarah K. Meadows, Kimberly M. Newberry, Richard M. Myers, J. Nicholas CochranKit,Norgen,17270 Tagment DNA TDE1 Enzyme and Buffer,Illumina,20034197 Q5 HotStart Master Mix,NEB,M0494S Arima-HiC+ Genome-Wide Hi-C Kit,Arima Genomics,A410232 ,, Deposited data,Deposited data,Deposited

(15) Characterizing RNA 3D structural features from DMS reactivityNucleic Acids ResJuly 17, 2026D H Sanduni Deenalattha, Chris P Jurich, Bret Lange, Darren Armstrong, Kaitlyn Nein, Sakshi Jain, Brandon G Kircher, Joseph D Yesselman(GTTGTTGTTGTTGTTTCTTT) primers from IDT. Each 50 μl reaction contained 25 μl Q5 High-Fidelity DNA Polymerase (NEB #M0494S), 2 μl oligo pool, 2.5 μl each primer (diluted to 10 μM from 100 μM stock), and 18 μl RNase-free UltraPure

(16) Acute in vivo proximity labeling for membrane targeted proteomics in neuronal circuitsbioRxivJuly 16, 2026Maribel Anguiano, Run Zhang, Melanie Robles, Kaden P. Adams, Michelle R. Salemi, Brett S. Phinney, Christopher S. Leung, Ethan M. Fenton, Kuldeep Giri, Elinor Lewis, et al.restriction enzymes (New England BioLabs; NEB) following standard digestion protocols. Q5 polymerase (M0494S, NEB) was used to amplify PCR fragments. Backbone vectors and PCR inserts were purified using gel electrophoresis

(17) A peptide-based screen for cell death inhibitors identifies the cytoprotective compound CDL36bioRxivJuly 10, 2026Zintis Inde, Sebastian Keppler, Jesse Gelles, Cameron S. Fraser, Adam Presser, Jarvier N. Mohammed, May Jung, David S. Garvey, Tudor Moldoveanu, Jerry E. Chipuk, et al.PCR amplification was performed using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs, cat #M0494S) and the attB PCR product was cloned into the pDONR221 plasmid (Thermo Fisher Scientific, cat # 2536017)

(18) Hierarchical lineage tracing reveals diverse pathways of cytarabine resistanceNature CommunicationsJune 30, 2026Rachel Saxe, Hannah Stuart, Abigail C. Marshall, Fahiima Abdullahi, Zoë Chen, Francesco Emiliani, Aaron McKennapreparation and sequencing All PCR reactions were conducted using Q5 HotStart Polymerase (NEB cat # M0494L) and Sybr Green dye. DNA was purified from PCR reactions using Omega TotalPure NGS magnetic beads with

(19) FATP2-mediated lipid metabolism enhances chimeric antigen receptor T-cell therapy resistance in B-cell acute lymphoblastic leukemiaLeukemiaJune 30, 2026Clarissa Garcia, Kaylyn Utley Lyons, Julian Grandvallet Contreras, Tian Liu, Alexis J. Donnelly, Amanda J. Novak, Amy Argabright, Colin Anderson, Abby Grier, Sabrina Smith, et al.subjected to PCR amplification using Q5 HotStart High-Fidelity Master Mix (New England Biolabs, Cat# M0494), 10 μM forward primer, 10 μM reverse primer using the following PCR conditions: initial denaturation

(20) SOS-mediated prophage induction constrains resistance evolution to DNA-damaging antibioticsbioRxivJune 27, 2026Amy D. Zamora, Shreyas V. Pai, Kepler S. Mears, Fernando Rossine, Siân V. Owen, Michael BaymPCR reactions for cloning and recombineering were performed with Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S) according to manufacturer instructions. PCR products were purified using the Monarch® Spin PCR & DNA Cleanup Kit

Write a Review

(1)

8/23/2023Robust DNA polymerase master mix Pavan Kumar ChodisettiI work with numerous strain variants of a bacterium that require verification once in a while. Some genes across the strains exhibit variations in both DNA sequence and length. I amplify these genes ... Read Review
(1)

1/2/2020DNA Insert Amplification for CloningDr. Thippeswamy SannasiddappaHighly recommended for amplifying error free longer length DNA inserts. Also, reactions can be set up room temperature.

Q5 Hot Start High-Fidelity 2X Master Mix

Q5 Hot Start High-Fidelity 2X Master Mix from New England Biolabs

New England Biolabs

Citations (565)

Reviews

Q5 Hot Start High-Fidelity 2X Master Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map