T7 DNA Ligase M0318S from New England Biolabs

Product Specs
ItemT7 DNA Ligase
CompanyNew England Biolabs
Price $75.00 Inquire
Catalog NumberM0318S
Size100000 units
ApplicationsDNA Manipulation
TypeEnzymes
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) The CIP2A-TOPBP1 axis facilitates mitotic DNA repair via MiDAS and MMEJNature CommunicationsNovember 27, 2025Peter R. Martin, Jadwiga Nieminuszczy, Zuza Kozik, Nihal Jakub, Szymon Kowalski, Maxime Lecot, Julia Vorhauser, Karen A. Lane, Alexandra Kanellou, Jörg Mansfeld, et al.DTT, 1 mM ATP, 0.5 µl of FastDigest BbsI (Thermo Scientific, ER1011), 0.25 µl of T7 DNA ligase (NEB, M0318S) in a final reaction volume of 10 µl. The reaction mixture was then incubated 37 °C for 5 min then 23

(2) Escherichia coli gene expression is influenced more by gut environmental changes from inflammation and microbiota modulation than by colitis severityScientific ReportsNovember 6, 2025Jungtak Kim, Karolina Hanna Prazanowska, Merlin Jayalal Lawrence Panchali, Chaeyeon Moon, Kyongmin Kim, Su Bin Lim, Sun Park(AAAGCCAAATCTTCCACTTGCAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCAAGTGGAAGATTTGG, Bioneer) using T7 DNA ligase (NEB, M0318S). The 99 cycles of digestion and annealing reactions were done at 37 °C for 3 min and at 20 °C 3 min,

(3) Directed Evolution in Escherichia coli for Novel Ligand-Binding Regulators: Evolving a Progesterone-Responsive Transcription Factor to Bind CortisolCurr ProtocOctober 22, 2025Alia Clark-ElSayed, Kaila E. Nayvelt, Satoshi Ishida, Simon d'Oelsnitz, Andrew D. EllingtonR3733S)T4 ligase buffer (New England Biolabs, cat. no. B0202S)T7 DNA ligase (New England Biolabs, cat. no. M0318S)PCR clean‐up kit (New England Biolabs, cat. no. T1030S) 20‐, 200‐, and 1000‐µl single‐channel pipettes

(4) TXNIP mediates LAT1/SLC7A5 endocytosis to limit amino acid uptake in cells entering quiescenceThe EMBO JournalOctober 20, 2025Jennifer Kahlhofer, Nikolas Marchet, Kristian Zubak, Brigitta Seifert, Madlen Hotze, Anna-Sophia Egger-Hörschinger, Lucija Kucej, Claudia Manzl, Yannick Weyer, Sabine Weys, et al.beads,NanoTagBiotechnologies,Cat. #N1516 Phusion™ High-Fidelity DNA Polymerase,NEB,M0530S T7 DNA Ligase,NEB,M0318S Micro BCA Protein Assay Kit,Thermo Fisher Scientific,Cat. #23235 RNeasy Mini Kit,Quiagen,Cat. #74104 LunaScript

(5) The pH-dependent photophysical and spectral properties of pH-sensing green fluorescent proteinsPhysiol RepOctober 18, 2025Ian M. ThornellR3189S New England Biolabs), then ligated into their respective vectors using a T7 DNA Ligase Kit (M0318S New England Biolabs). All vectors were confirmed by DNA sequencing (GENEWIZ). The newly generated sfGFP‐mCRISPRed

(6) Requirements for establishment and epigenetic stability of mammalian heterochromatinMolecular CellSeptember 18, 2025Antonis Tatarakis, Harleen Saini, Juntao Yu, Wenzhi Feng, Carlos A. Pinzon-Arteaga, Danesh Moazed,Thermo Fisher Scientific,Cat# BY5 Esp3I (BsmBI),Thermo Fisher Scientific,Cat# ER0451 T7 DNA ligase,NEB,Cat# M0318S Ex Taq® DNA Polymerase,Takara,Cat# RR001A "Paraformaldehyde, 16%",Ted pella,Cat# 18505 Donkey Serum

(7) Scalable generation and functional classification of genetic variants in inborn errors of immunity to accelerate clinical diagnosis and treatmentCellSeptember 4, 2025Zachary H. Walsh, Chris J. Frangieh, Neeharika Kothapalli, Jay Levy, Clarissa K. Heck, Johannes C. Melms, Ron S. Gejman, Parin Shah, Jared M. Pollard, Akul Naik, et al.(Thermo Fisher, #R0861), 1 mM ATP (NEB, # P0756S), 1 μl Esp3l (Thermo Scientific, #ER0451), T7 ligase (NEB, #M0318S) and nuclease free water. The reaction was conducted in a thermocycler with 99 cycles of incubation

(8) Metastatic breast cancer cells are selectively dependent on the mitochondrial cristae-shaping protein OPA1Cell Death DisJuly 21, 2025Antigoni Diokmetzidou, Aurora Maracani, Anna Pellattiero, Mauricio Cardenas-Rodriguez, Erwan A. Rivière, Luca ScorranolentiCRISPR v2 plasmid (Addgene, Plasmid # 52961) using a T7 DNA Ligase (New England Biolabs (NEB), Cat. #M0318S). The DNA product was transformed into chemically competent XL10-Gold bacteria and grown on Ampicillin

(9) An Alternative Gene Editing Strategy Using a Single AAV VectorBIO-PROTOCOLJuly 5, 2025Jamie C. Moffa, Vani Kalyanaraman, Bryan A. Copits(New England BioLabs, catalog number: B0318S) 11. T7 DNA ligase (New England BioLabs, catalog number: M0318S) 12. SOC medium (New England BioLabs, catalog number: B9020S) 13. Carbenicillin (Sigma-Aldrich, catalog

(10) Protocol for high-efficiency generation of iPSCs stably expressing Cas9-EGFP using the selection by essential gene exon knockin methodSTAR ProtocJuly 4, 2025Yao Zhang, Hao Yang, Yuan Yang, Zijun Lu, Lokyu Cheng, Hongmei Tan, Joe Z. Zhangsolution,Lucigen,Cat#QE09050 RIPA,Solarbio,Cat#R0010 Stemflex,Gibco,Cat#A3349401 T4 DNA ligase,NEB,Cat#M0202S T7 DNA ligase,NEB,Cat#M0318S Y-27632·2HCl,MCE,Cat#HY-10071 ,, Critical commercial assays,Critical commercial assays,Critical commercial

(11) Characterizing protein sequence determinants of nuclear condensates by high-throughput pooled imaging with CondenSeqNature MethodsJuly 1, 2025Kalli Kappel, Daniel Strebinger, KeHuan K. Edmonds, Samuel Chau-Duy-Tam VO, Christopher M. Vockley, Tridib Biswas, Samouil L. Farhi, Rhiannon Macrae, Feng Zhang, Aviv RegevATP (New England Biolabs Cat. # P0756S), 2.4 μL Esp3I, 2.4 μL T7 ligase (New England Biolabs Cat. # M0318S), 0.081 pmol digested backbone plasmid, 0.162 pmol insert library). For the small pools, reactions were

(12) High-throughput metabolic engineering of Yarrowia lipolytica through gene expression tuningProc Natl Acad Sci U S AJune 10, 2025Wei Jiang, Shengbao Wang, Daniel Ahlheit, Tommaso Fumagalli, Zhijie Yang, Shreemaya Ramanathan, Xinglin Jiang, Tilmann Weber, Jonathan Dahlin, Irina BorodinaμL of each insert plasmid, 1 μL of T4 DNA ligase buffer (NEB, B0202S), 1 μL of T7 DNA ligase (NEB, M0318S), 1 ul of SapI (NEB, R0569S), and water to a total volume of 20 μL. These reaction mixtures were subjected

(13) Generation of iPSC Lines with Tagged α-Synuclein for Visualization of Endogenous Protein in Human Cellular Models of Neurodegenerative DisorderseNeuroJune 2, 2025Oskar G. Zetterdahl, James A. Crowe, Samira Reyhani, Miriam A. Güra, Ot Labastida-Botey, Aline S. Girard, D. Sean Froese, Henrik Ahlenius, Isaac Canals1 µl FastDigest BpiI (Thermo Fisher Scientific #FD1014), 0.5 µl T7 DNA ligase (New England Biolabs #M0318S), 1 µl DTT (10 mM, Thermo Fisher Scientific #P2325), and 1 µl ATP (10 mM, New England Biolabs #P0756S),

(14) Massively parallel reporter assay investigates shared genetic variants of eight psychiatric disordersCellMarch 6, 2025Sool Lee, Jessica C. McAfee, Jiseok Lee, Alejandro Gomez, Austin T. Ledford, Declan Clarke, Hyunggyu Min, Mark B. Gerstein, Alan P. Boyle, Patrick F. Sullivan, et al.digested oligo library was ligated into the Donor_eGP2AP_RC plasmid using T7 DNA ligase (NEB, cat. no. M0318S). The ligation mix was transformed into Endura Electrocompetent cells (Lucigen, cat. no. 60242-1) via

(15) Mapping variant effects on anti-tumor hallmarks of primary human T cells with base-editing screensNature BiotechnologyMarch 1, 2025Zachary H. Walsh, Parin Shah, Neeharika Kothapalli, Shivem B. Shah, Gergo Nikolenyi, D. Zack Brodtman, Giuseppe Leuzzi, Meri Rogava, Michael Mu, Patricia Ho, et al.(Thermo Fisher, R0861), 1 mM ATP (NEB, P0756S), 1 μl Esp3l (Thermo Scientific, ER0451), T7 ligase (NEB, M0318S) and nuclease-free water. The reaction was conducted in a thermocycler using incubation at 37 °C for

(16) Massively parallel assessment of gene regulatory activity at human cortical structure associated variantsbioRxivFebruary 13, 2025Nana Matoba, Jessica C. McAfee, Oleh Krupa, Jess Bell, Brandon D. Le, Jordan M. Valone, Gregory E. Crawford, Hyejung Won, Jason L. Steincat#D4007). The digested plasmid and oligo library was ligated together using T7 DNA ligase (NEB, cat#M0318S) at room temperature for 30 minutes followed by clean up via Zymo clean and concentrator-5 kit. The

(17) Directed evolution of an orthogonal transcription engine for programmable gene expression in eukaryotesiScienceJanuary 17, 2025Shaunak Kar, Elizabeth C. Gardner, Kamyab Javanmardi, Daniel R. Boutz, Raghav Shroff, Andrew P. Horton, Thomas H. Segall-Shapiro, Andrew D. Ellington, Jimmy Gollihar"Opti-MEM I Reduced Serum Medium, GlutaMAX Supplement",GIBCO,51985091 Lipofectamine 3000 Transfection Reagent,Thermo Fisher,L3000015 Esp3I,NEB,R0734 T7 DNA Ligase,NEB,M0318S T4 DNA Ligase,NEB,B0202S BsaI-HF-v2,NEB,R3733L Platinum SuperFi DNA polymerase,ThermoFisher,12351010 Minimal

(18) Long-range regulation of transcription scales with genomic distance in a gene-specific mannerMolecular CellJanuary 16, 2025Christina L. Jensen, Liang-Fu Chen, Tomek Swigut, Olivia J. Crocker, David Yao, Mike C. Bassik, James E. Ferrell, Alistair N. Boettiger, Joanna WysockaR3575 10xTango Buffer,ThermoFisher,Cat# BY5 10x T4 Ligase Buffer,NEB,Cat# B0202S T7 DNA Ligase,NEB,Cat# M0318S T4 DNA Ligase (30U/uL),ThermoFisher,Cat# EL0013 BpiI,ThermoFisher,Cat# ER111 Herculease II Dusion

(19) Mechanical Force‐Induced cGAS Activation in Carcinoma Cells Facilitates Splenocytes into Liver to Drive MetastasisAdvanced ScienceDecember 31, 2024Xurui Zhang, Na Huang, Yanhua Mu, Haiyan Chen, Mengchen Zhu, Shaoying Zhang, Pengfei Liu, Hailong Zhang, Huan Deng, Keping Feng, et al.C3702 Protease inhibitor cocktail,Merck,Cat# 539134 BBS1,NEB,Cat# R0539V T7 DNA Ligase,NEB,Cat# M0318S T4 PNK,Sangon Biotech,Cat# B300053‐0500 Critical commercial assays,Critical commercial assays,Critical

(20) Cas10 relieves host growth arrest to facilitate spacer retention during type III-A CRISPR-Cas immunityCell Host & MicrobeDecember 11, 2024Naama Aviram, Amanda K. Shilton, Nia G. Lyn, Bernardo S. Reis, Amir Brivanlou, Luciano A. Marraffinicloning with BsaI-HFv2 (New England Biolabs Cat. #R3733S) and T7 DNA ligase (New England Biolabs Cat. #M0318S), then electroporated into Endura Duo electrocompetent cells (Biosearch Technologies Cat. # 60242).

Be the First to Write a Review!

T7 DNA Ligase

T7 DNA Ligase from New England Biolabs

New England Biolabs

Citations (55)

Reviews

T7 DNA Ligase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map