Alt-R™ S.p. HiFi Cas9 Nuclease V3 1081060 from Integrated DNA Technologies

Product Specs
ItemAlt-R™ S.p. HiFi Cas9 Nuclease V3
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1081060
Applicationsgenome editing, CRISPR
TypeEnzyme

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Multi-omic analysis reveals nitric oxide dependent remodeling in classically activated macrophages and identifies negative regulation mediated by AKR1A1Redox BiologyJune 1, 2026Nicholas L. Arp, Uzziah S. Urquiza, Marcel Morgenstern, Jonathan H. Schrope, James A. Votava, Steven V. John, Jack J. Stevens, Felicia Deng, Anna Huttenlocher, Joshua J. Coon, et al.Mm.Cas9.Akr1a1.1.AA; or crRNA Guide #2, IDT Design ID: Mm.Cas9.Akr1a1.1.AB), and 1 μM HiFi Cas9 nuclease (IDT, 1081060) in 100 μL Nucleofector solution with supplement from Mouse Macrophage Nucleofector Kit (Lonza, VPA-1009).

(2) Improved Cas9-targeted nanopore sequencing facilitates ultra-deep analysis of genomic variationCell Reports MethodsMay 18, 2026Nick Vereecke, Megan Behrmann, Anupama Khare, John P. Dekker(10 μM final), 10x NEB rCutSmart buffer (NEB B6004), and S. pyogenes HiFi Cas9 Alt-R nuclease V3 (IDT 1081060). A minimum of ten reactions was prepared to prevent pipetting of small volumes. Five μg concentrated

(3) Response of B cells specific for polyomavirus-derived oncoprotein is predictive of Merkel cell carcinoma tumor controlCancer Immunol ResMay 4, 2026Haroldo J. Rodriguez Chevez, Allison J. Remington, Matthew D. Gray, Rian Alam, Macy W. Gilmour, Carina Morningstar, Gabriel F. Alencar, Thomas Pulliam, Erin M. McClure, Neha Singh, et al.gRNA AGAGTCTCTCAGCTGGTACA (IDT, custom order) was mixed with an equal volume of 24 mmol/L Cas9 (IDT #1081060) and 1/20th volume of 400 mmol/L Cas9 electroporation enhancer (IDT #1075916) and incubated at room

(4) Potent Anthranilic Anilide-Based TRPM4 Channel Inhibitors Identified by a Structure-Activity Relationship StudyJ Med ChemApril 23, 2026Christian E. Gerber, Bartlomiej S. Augustynek, Philipp Grossenbacher, Barbara Hauert, Simon A. Singer, Christine Peinelt, Martin Lochnerduplexes. Each gRNA was subsequently complexed with Alt-R S.p. HiFi Cas9 Nuclease V3 (IDT, Cat. No. 1081060) according to manufacturer’s instructions. HCT116 cells were transfected using Lipofectamine CRISPRMAX

(5) Intron retention regulates STAT2 function and predicts immunotherapy response in lung cancerbioRxivApril 21, 2026Ryan P. Englander, Mattia Brugiolo, Te-Chia Wu, Mitch Kostich, Nathan K. Leclair, SungHee Park, Jacques Banchereau, Peter Yu, Andrew Salner, Romain Banchereau, et al.synthesized (Synthego). 16 μg of sgRNA was incubated with 20 μg of Alt-R HiFi Cas9 Nuclease V3 (IDT #1081060) for 30 minutes at room temperature. A549 cells were harvested and nucleofected with the sgRNA:Cas9

(6) Molecular and functional dissection using CaMPARI-seq reveals the neuronal organization for dissociating optic flow-dependent behaviorsNat CommunApril 17, 2026Koji Matsuda, Chung-Han Wang, Hisaya Kakinuma, Atsushi Toyoda, Tomoya Shiraki, Koichi Kawakami, Fumi KuboNuclease-Free Duplex Buffer (IDT, Cat# 11-05-01-12) and subsequently incubated with Cas9 protein (IDT, Cat# 1081060) at 37 °C for 15 min. Another CRISPR-Cas9 RNP complex targeting either G-bait or M-bait sequence of

(7) Local heterochromatin enrichment promotes telomere clustering and PML nuclear body assembly at telomeresCell ReportsMarch 24, 2026Erin R. Taylor, Bruce Proctor, Melina Vaurs, Guanhui Wu, Manon Mahieu, Shreya Shrestha, Daniel Morrison, Laila Weatherly, Shane Brelinsky, Maya Raghunandan, et al.were generated in HeLa LT cells, using ribonucleoprotein (RNP) electroporation. Cas9 protein (IDT; 1081060) and synthetic sgRNAs targeting ATRX or PML (Synthego) were assembled into RNP complexes by mixing 2

(8) Nonsense-mediated mRNA decay safeguards telomeres in pluripotent stem cellsNature Cell BiologyMarch 24, 2026Marta Markiewicz-Potoczny, Si Young Lee, Soniya Chatterjee, Justin W. Mabin, Anna Zinsser, Ranjodh Sandhu, Gianna Tricola, J. Robert Hogg, Eros Lazzerini Denchicontaining three synthetic gRNAs (GKOv2 kits, Synthego, now EditCo) and Cas9 Nuclease V3 (100 µg; IDT, 1081060). Clonal lines were isolated, screened by PCR and validated by Sanger sequencing and immunoblotting.

(9) MASTR-seq enables multiplexed analysis of short tandem repeats with sequencingCell Rep MethodsMarch 23, 2026Chuanbin Su, Han-Seul Ryu, Keerthivasan Raanin Chandradoss, Thomas Malachowski, Ravi Boya, Linda Zhou, Hoa Emma Nguyen, Esteban O. Mazzoni, Kristen J. Brennand, Jennifer E. Phillips-CreminsCutSmart buffer, 78.4 μL nuclease-free water (Sigma-Aldrich#W4502), and 1.6 μL of 62 μM HiFi Cas9 (IDT#1081060). We incubated the mixture at room temperature for 30 min and then placed it on ice until use. HMW

(10) Response of B cells specific for polyomavirus-derived oncoprotein is predictive of Merkel cell carcinoma tumor controlCancer Immunology ResearchMarch 4, 2026Haroldo J. Rodriguez Rodriguez Chevez, Allison J. Remington, Matthew D. Gray, Rian Alam, Macy W. Gilmour, Carina Morningstar, Gabriel F. Alencar, Thomas Pulliam, Erin M. McClure, Neha Singh, et al.gRNA AGAGTCTCTCAGCTGGTACA (IDT, custom order) was mixed with an equal volume of 24 mmol/L Cas9 (IDT #1081060) and 1/20th volume of 400 mmol/L Cas9 electroporation enhancer (IDT #1075916) and incubated at room

(11) CRISPR/Cas9-mediated B2m knockout paves the way for allogeneic basal cell transplantationRespiratory ResearchFebruary 28, 2026Huanjie Chen, Weizhan Luo, Ning Ma, Shiyue LiCRISPR/Cas9, the single guide RNA (sgRNA) was obtained from Ubigene company (China), and Cas9 protein (#1081060) was purchased from Integrated DNA Technologies company (USA). The sequence of the sgRNA is AGTATACTCACGCCACCCAC.

(12) Uncovering genetic interactions in the DNA repair network in response to endogenous damage and ionizing radiationCell ReportsJanuary 27, 2026Benjamin Nebenfuehr, Lynn Sanford, Erin R. Taylor, Kerri Ball, Catherine E. Woods-Killam, Hannah I. Ghasemi, Bruce Proctor, Raquel Ortega, Colin Sempeck, Robin D. Dowell, et al.was also knocked out in U2-OS cells using ribonucleoprotein (RNP) electroporation. Cas9 protein (IDT; 1081060) and synthetic sgRNA targeting respective genes (Synthego) were used to assemble the RNP complex. To

(13) Breaking the cell wall for efficient DNA delivery to diatomsNature CommunicationsJanuary 22, 2026E. J. L. Walker, M. Pampuch, L. Deng, Y. Li, G. Tran, T. Mock, B. J. Karasviewed in the Source Data file. Preparation of Cas9:sgAPT1 complex HiFi Cas9 nuclease (catalog number: 1081060) and synthetic sgRNA were purchased from Integrated DNA Technologies (IDT) and prepared according to

(14) Brain organoid models of SZT2-related disease reveal an overproduction of outer radial glial cells through mTORC1 activationScientific ReportsJanuary 14, 2026Emi Sato, Yuji Nakamura, Masanori Fujimoto, Issei S. Shimada, Toshihiko Iwaki, Daisuke Ieda, Yutaka Negishi, Ayako Hattori, Yoichi Kato, Shinji SaitohNext, 1 µL of 62 µM Cas9 protein (Alt-R™ S.p. HiFi Cas9 Nuclease V3, Integrated DNA Technologies, Cat#1081060) was added to the gRNA complex and incubated at RT for 30 min to form the RNP complex. Subsequently,

(15) A human CAGinSTEM platform for decoding HTT repeats' somatic instability links CAG interruption to HD pathology in neuronsCell RepDecember 23, 2025Martina Zobel, Gianluca Damaggio, Maria Lidia Mignogna, Dario Besusso, Davide Scalzo, Andrea Cossu, Camilla Trovesi, Mariacristina Crosti, Francesco Cortina, Ilaria Campus, et al.pUC57_HDR_RMCE_107Q_PuroR donor plasmid and 20 pmol of equimolar Alt-R S.p. HiFi Cas9 Nuclease V3 (IDT # 1081060) and sgRNA RNP complex using Nucleofector kit (Lonza), in Nucleofector II (Amaxa biosystems) using B-016

(16) A fully iPS-cell-derived 3D model of the human blood–brain barrier for exploring neurovascular disease mechanisms and therapeutic interventionsNature NeuroscienceDecember 15, 2025Judit González-Gallego, Katalin Todorov-Völgyi, Stephan A. Müller, Sophie Antesberger, Mihail Ivilinov Todorov, Rainer Malik, Rita Grimalt-Mirada, Carolina Cardoso Gonçalves, Martina Schifferer, Georg Kislinger, et al.(ttcttccgcggcgcctaccaggg, ordered from Synthego) was mixed with 30 pmol of high-fidelity Cas9 mutant (IDT, cat. no. 1081060) and incubated at RT for 10–20 min. After Accutase dissociation, 200,000 cells were resuspended in 20

(17) Nef stabilizes actin to prevent HIV-1 sensing by RIG-I-like receptorsNat CommunDecember 7, 2025Alexandre Laliberté, Caterina Prelli Bozzo, Dhiraj Acharya, Aurora De Luna, Maximilian Hirschenberger, Junji Zhu, Meta Volcic, Bettina Stolp, Cristina M. Rodriguez-Quinteros, Oliver T. Fackler, et al.FCS. For MDMs, 1 × 106 primary monocytes were transfected with the HiFi Cas9 Nuclease V3 (IDT, Cat# 1081060)/gRNA complex (80 pmol/300 pmol) using a non-targeting (NT) control (5´-ACG GAG GCT AAG CGT CGC AA-3´)

(18) A phenotypic brain organoid atlas and biobank for neurodevelopmental disordersCell Stem CellDecember 4, 2025Lu Wang, Yuji Nakamura, Junhao Li, David Sievert, Yang Liu, Toan Nguyen, Prudhvi Sai Jetti, Ethan Thai, Rachel Yibei Zhou, Jiaming Weng, et al."Phosphate-buffered saline (PBS, 1X), sterile-filtered",Thermo Fisher Scientific,Cat#J61196-AP Alt-R™S.p. HiFi-Cas9 Nuclease V3,Integrated DNA Technologies,Cat#1081060 "Alt-R™CRISPR-Cas9 tracrRNA, ATTO™ 550",Integrated DNA Technologies,Cat#1075927 Alt-R™ HDR Enhancer V2

(19) Vinculin Y822 phosphorylation regulates adhesion remodeling during cardiomyocyte maturationJournal of Cell ScienceNovember 13, 2025Xiaofei Li, Rainy Wortelboer, Yi Song, Sahana Balasubramanian, Callie McLain, Alex Hernandez Hernandez Manriquez, Joseph D. Suh, Brenton D. Hoffman, Adam V. Kwiatkowski, Glenn L. RadiceTransgenic and Gene-Targeting Facility. The injection mix contained 100 ng µl−l SpCas9 nuclease [Cat. No. 1081060, Integrated DNA Technologies (IDT)], 150 ng µl−l the annealed guide RNA (crRNA:tracrRNA, IDT), and 250

(20) Human iPSC-derived glutamatergic neurons with pathogenic KCNQ2 variants display hyperactive bursting phenotypesNeurobiology of DiseaseNovember 1, 2025Maria Sundberg, Carole Shum, Erika M. Norabuena, Nina R. Makhortova, Cidi Chen, Lucy Yu, Emma V. Wightman, Kristina Kim, Sang Yeon Han, Jennifer Howe, et al.ribonucleoprotein (RNP) complex of sgRNA and ssODN as well as Cas9 protein (Alt-R® S.p. HiFi Cas9 Nuclease V3, IDT #1081060) were transfected into 2 × 10^5 iPSCs by electroporation under 1000–1400 V, 20 ms, 1 pulse setting,

Be the First to Write a Review!

Alt-R™ S.p. HiFi Cas9 Nuclease V3 from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (197)

Reviews

Alt-R™ S.p. HiFi Cas9 Nuclease V3 from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map