Alt-R™ S.p. HiFi Cas9 Nuclease V3 1081060 from Integrated DNA Technologies

Product Specs
ItemAlt-R™ S.p. HiFi Cas9 Nuclease V3
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1081060
Applicationsgenome editing, CRISPR
TypeEnzyme

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Reassessment of the roles of coronin proteins as actin effectors and in signalingPLoS BiolAugust 18, 2026Roko Gvozdenica Šipić, Haiyan Zhang, Andrii Kharin, Jerneja Koren, Viviana D'Otolo, Yuko Nariai, Takeshi Urano, Pawel Pelczar, Klemens Fröhlich, Alexander Schmidt, et al.peptide mixture for coronin 2",This paper, "Alt-R S.p. HiFi Cas9 Nuclease V3, 100 μg, 10 μl","IDT, CAT: 1081060", EDTA solution,Produced in-house, Tris-glycine buffer,Produced in-house, MgCl2,"Sigma, CAT:M8266-1KG", PIPES,"Sigma,

(2) Trdn-as directs m6A-dependent transcriptional termination for accurate triadin isoform switching, preventing aberrant dyads and cardiomyopathyNat CommunJuly 25, 2026Theresa Hofmann, Sara Hettrich, Bio Maria Ghéo Idrissou, Christian Waechter, Maria Weiss, Salma Hachim, Silke Kreher, Maximilian Staps, Laia Cañes Esteve, Sabine Pankuweit, et al.complex was generated by mixing 3 µl of the annealed oligo and 2 µl Alt-R Cas9 Hifi Enzyme V3 (IDT, #1081060) and incubating for 50 min at RT. A single-cell solution of hiPSCs was prepared using Accutase solution

(3) Disruption of microhomology-mediated end joining in Ewing sarcomaMol CellJuly 21, 2026Shuhei Asada, Guangli Zhu, Jithma Prasad Abeykoon, Yutaro Tanaka, Huy Nguyen, Yuna Hirohashi, Divya R. Iyer, Nicholas William Ashton, Sirisha Mukkavalli, Martha Velazquez, et al.Crystal violet,Sigma-Aldrich,Cat# C0775 Alt-R S.p. HiFi Cas9 Nuclease V3,Integrated DNA Technologies,Cat# 1081060 Alt-R Cas9 Electroporation Enhancer,Integrated DNA Technologies,Cat# 1075915 Micrococcal Nuclease,Thermo Fisher Scientific

(4) LIG1 Loss in TP53-mutant Triple Negative Breast Cancer Rewires DNA Repair and Confers Sensitivity to PARP-ATR Inhibitor CombinationsMol Cancer TherJuly 15, 2026Anh Minh Tran Huynh, Jonathan T. Lei, Rachel Brough, Christina Sallas, Jun Xu, Jacob B. Pilcher, Xuxu Gou, Junkai Wang, Lacey E. Dobrolecki, Diana M. Fandino, et al.For each electroporation, 50 pmol of sgRNA was pre-incubated with 20 pmol of Cas9 nuclease (IDT, Cat# 1081060) at room temperature for 10–20 minutes to assemble the RNP complex prior to delivery. Following electroporation,

(5) Karyoptosis mediates cell death and neurodegeneration upon proteotoxic stressNat CommunJune 25, 2026Rebecca Casterton, Aitana Martinez-Cotrina, Jodi Barnard, Eleanor Wycherley, Yanling Hu, Rhys Anderson, Sebastien Janel, Jiin Byun, Olivia Houghton, Daniel A. Solomon, et al.vector, a CLYBL locus-targeting gRNA (5′-ATGTTGGAAGGATGAGGAAA-3′, IDT) and recombinant Cas9 nuclease (1081060, IDT) using a Nucleofector 2B (Lonza, VPH-5022 kit). At 7 days post-electroporation, positive cells

(6) A cross-vertebrate brain protein interaction map identifies conserved neural and non-neural complexesCell ReportsJune 23, 2026Vy Dang, Brittney Voigt, David Yang, Gabriel Hoogerbrugge, Muyoung Lee, Rachael M. Cox, Ophelia Papoulas, Claire D. McWhite, Raksha Pradeep, Janelle C. Leggere, et al.and recombinant proteins" GoTaq Green,Promega,Cat# M7123 AltR S.p. HiFi Cas9 Nuclease V3,IDT,Cat# 1081060 Critical commercial assays,Critical commercial assays,Critical commercial assays Pierce Quantitative Colorimetric Peptide Assay

(7) Multi-omic analysis reveals nitric oxide dependent remodeling in classically activated macrophages and identifies negative regulation mediated by AKR1A1Redox BiologyJune 1, 2026Nicholas L. Arp, Uzziah S. Urquiza, Marcel Morgenstern, Jonathan H. Schrope, James A. Votava, Steven V. John, Jack J. Stevens, Felicia Deng, Anna Huttenlocher, Joshua J. Coon, et al.Mm.Cas9.Akr1a1.1.AA; or crRNA Guide #2, IDT Design ID: Mm.Cas9.Akr1a1.1.AB), and 1 μM HiFi Cas9 nuclease (IDT, 1081060) in 100 μL Nucleofector solution with supplement from Mouse Macrophage Nucleofector Kit (Lonza, VPA-1009).

(8) Light- and chemical-induced ciliary signaling governs dorsal/ventral regionalization of human telencephalic organoidsNature CommunicationsMay 22, 2026Issei S. Shimada, Akari Goto, Yutaka Hashimoto, Hajime Inoue, Takuto Sugawara, Tomohiro Doura, Tsubasa Fujita, Toshiaki Iwata, Riko Shimmoto, Hiroshi Takase, et al.guide RNA (sgRNA) complex. One µL of 62 µM Alt-R S.p. HiFi Cas9 protein (Integrated DNA Technologies, 1081060) was added to the sgRNA complex and incubated in the dark at room temperature for 30 min to form an

(9) Improved Cas9-targeted nanopore sequencing facilitates ultra-deep analysis of genomic variationCell Reports MethodsMay 18, 2026Nick Vereecke, Megan Behrmann, Anupama Khare, John P. Dekker(10 μM final), 10x NEB rCutSmart buffer (NEB B6004), and S. pyogenes HiFi Cas9 Alt-R nuclease V3 (IDT 1081060). A minimum of ten reactions was prepared to prevent pipetting of small volumes. Five μg concentrated

(10) Distinct pathophysiological mechanisms of CEP152 variants in microcephaly and brain abnormalitiesEMBO Molecular MedicineMay 5, 2026Nanako Hamada, Lama AlAbdi, Tomoko Uehara, Looprasertkul Sasikarn, Takuma Nishijo, Reut Suliman-Lavie, Mais O Hashem, Majid Alfadhel, Shatha Alhefdhi, Brahim Tabarki, et al.(5′- CCGTGTGACACTGATGTGACTGCCCTTACTCAGTTGCAGCCGCTACTCACAGACCTCCCTCACGACATGCTGGACGATGA-3′), Cas9 (cat# 1081060), and tracrRNA (cat# 1072534) were obtained from Integrated DNA Technologies Inc. For the i-GONAD procedure,

(11) Response of B cells specific for polyomavirus-derived oncoprotein is predictive of Merkel cell carcinoma tumor controlCancer Immunol ResMay 4, 2026Haroldo J. Rodriguez Chevez, Allison J. Remington, Matthew D. Gray, Rian Alam, Macy W. Gilmour, Carina Morningstar, Gabriel F. Alencar, Thomas Pulliam, Erin M. McClure, Neha Singh, et al.gRNA AGAGTCTCTCAGCTGGTACA (IDT, custom order) was mixed with an equal volume of 24 mmol/L Cas9 (IDT #1081060) and 1/20th volume of 400 mmol/L Cas9 electroporation enhancer (IDT #1075916) and incubated at room

(12) A combinatorial domain screening platform reveals epigenetic effector interactions for transcriptional perturbationNature CommunicationsApril 24, 2026Hyungseok C. Moon, Michael H. Herschl, Alessandra Sclip, Vincent Q. Tran, April Pawluk, Silvana Konermann, Patrick D. Hsutowards the barcoded bivalent effector region (Supplementary Fig. 3i). First, two Alt-R S.p. Cas9 (IDT, 1081060) RNP pools were made, one containing the outer guides M1 and P1 and the other containing the inner guides

(13) Potent Anthranilic Anilide-Based TRPM4 Channel Inhibitors Identified by a Structure-Activity Relationship StudyJ Med ChemApril 23, 2026Christian E. Gerber, Bartlomiej S. Augustynek, Philipp Grossenbacher, Barbara Hauert, Simon A. Singer, Christine Peinelt, Martin Lochnerduplexes. Each gRNA was subsequently complexed with Alt-R S.p. HiFi Cas9 Nuclease V3 (IDT, Cat. No. 1081060) according to manufacturer’s instructions. HCT116 cells were transfected using Lipofectamine CRISPRMAX

(14) Intron retention regulates STAT2 function and predicts immunotherapy response in lung cancerbioRxivApril 21, 2026Ryan P. Englander, Mattia Brugiolo, Te-Chia Wu, Mitch Kostich, Nathan K. Leclair, SungHee Park, Jacques Banchereau, Peter Yu, Andrew Salner, Romain Banchereau, et al.synthesized (Synthego). 16 μg of sgRNA was incubated with 20 μg of Alt-R HiFi Cas9 Nuclease V3 (IDT #1081060) for 30 minutes at room temperature. A549 cells were harvested and nucleofected with the sgRNA:Cas9

(15) Molecular and functional dissection using CaMPARI-seq reveals the neuronal organization for dissociating optic flow-dependent behaviorsNat CommunApril 17, 2026Koji Matsuda, Chung-Han Wang, Hisaya Kakinuma, Atsushi Toyoda, Tomoya Shiraki, Koichi Kawakami, Fumi KuboNuclease-Free Duplex Buffer (IDT, Cat# 11-05-01-12) and subsequently incubated with Cas9 protein (IDT, Cat# 1081060) at 37 °C for 15 min. Another CRISPR-Cas9 RNP complex targeting either G-bait or M-bait sequence of

(16) Local heterochromatin enrichment promotes telomere clustering and PML nuclear body assembly at telomeresCell ReportsMarch 24, 2026Erin R. Taylor, Bruce Proctor, Melina Vaurs, Guanhui Wu, Manon Mahieu, Shreya Shrestha, Daniel Morrison, Laila Weatherly, Shane Brelinsky, Maya Raghunandan, et al.were generated in HeLa LT cells, using ribonucleoprotein (RNP) electroporation. Cas9 protein (IDT; 1081060) and synthetic sgRNAs targeting ATRX or PML (Synthego) were assembled into RNP complexes by mixing 2

(17) Nonsense-mediated mRNA decay safeguards telomeres in pluripotent stem cellsNature Cell BiologyMarch 24, 2026Marta Markiewicz-Potoczny, Si Young Lee, Soniya Chatterjee, Justin W. Mabin, Anna Zinsser, Ranjodh Sandhu, Gianna Tricola, J. Robert Hogg, Eros Lazzerini Denchicontaining three synthetic gRNAs (GKOv2 kits, Synthego, now EditCo) and Cas9 Nuclease V3 (100 µg; IDT, 1081060). Clonal lines were isolated, screened by PCR and validated by Sanger sequencing and immunoblotting.

(18) MASTR-seq enables multiplexed analysis of short tandem repeats with sequencingCell Rep MethodsMarch 23, 2026Chuanbin Su, Han-Seul Ryu, Keerthivasan Raanin Chandradoss, Thomas Malachowski, Ravi Boya, Linda Zhou, Hoa Emma Nguyen, Esteban O. Mazzoni, Kristen J. Brennand, Jennifer E. Phillips-CreminsCutSmart buffer, 78.4 μL nuclease-free water (Sigma-Aldrich#W4502), and 1.6 μL of 62 μM HiFi Cas9 (IDT#1081060). We incubated the mixture at room temperature for 30 min and then placed it on ice until use. HMW

(19) Response of B cells specific for polyomavirus-derived oncoprotein is predictive of Merkel cell carcinoma tumor controlCancer Immunology ResearchMarch 4, 2026Haroldo J. Rodriguez Rodriguez Chevez, Allison J. Remington, Matthew D. Gray, Rian Alam, Macy W. Gilmour, Carina Morningstar, Gabriel F. Alencar, Thomas Pulliam, Erin M. McClure, Neha Singh, et al.gRNA AGAGTCTCTCAGCTGGTACA (IDT, custom order) was mixed with an equal volume of 24 mmol/L Cas9 (IDT #1081060) and 1/20th volume of 400 mmol/L Cas9 electroporation enhancer (IDT #1075916) and incubated at room

(20) CRISPR/Cas9-mediated B2m knockout paves the way for allogeneic basal cell transplantationRespiratory ResearchFebruary 28, 2026Huanjie Chen, Weizhan Luo, Ning Ma, Shiyue LiCRISPR/Cas9, the single guide RNA (sgRNA) was obtained from Ubigene company (China), and Cas9 protein (#1081060) was purchased from Integrated DNA Technologies company (USA). The sequence of the sgRNA is AGTATACTCACGCCACCCAC.

Be the First to Write a Review!

Alt-R™ S.p. HiFi Cas9 Nuclease V3 from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (207)

Reviews

Alt-R™ S.p. HiFi Cas9 Nuclease V3 from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map