VEGF-C Protein 9199-VC-025 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemVEGF-C Protein
CompanyR&D Systems, a Bio-Techne Brand
Price $400.00Supplier Page View Company Product Page
Catalog Number9199-VC-025
Size25 ug
ApplicationsBioactivity
Conjugate/TagUnconjugated
Purity>95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining
Molecular WeightObserved: 14-22 kDa, reducing conditions
Theoretical: 13 kDa
SpeciesHuman
Molecule NameVEGF-C
Source/Expression SystemCHO-derived Recombinant Human VEGF-C Protein
NCBI Full Gene Namevascular endothelial growth factor C
NCBI Gene AliasesLMPHM4, VRP, LMPH1D, Flt4-L
FormatLyophilized from a 0.2 µm filtered solution in HCl with BSA as a carrier protein
StorageUse a manual defrost freezer and avoid repeated freeze-thaw cycles. 12 months from date of receipt, -20 to -70 °C as supplied. 1 month, 2 to 8 °C under sterile conditions after reconstitution. 3 months, -20 to -70 °C under sterile conditions after reconstitution

Specifications/Features

Available conjugates: Sizes Available: 25 ug

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Further characterisation of immortalised human lymphatic endothelial cells to explore their transcriptomic profile and VEGFC responseSci RepDecember 13, 2025Kazim Ogmen, Ruby Moy, Sara E. Dobbins, Lotte van den Bent, Onno Kranenburg, Jeroen Hagendoorn, Alan Pittman, Pia Ostergaard, Silvia Martin-Almedinasupplemented endothelial cell growth medium-complete EBM MV2 (C-22022, PromoCell) containing 50 ng/mL VEGFC (9199-VC-025, Bio-techne) on plates coated with fibronectin from human plasma (1 ug/mL Sigma, F2006). In functional

(2) Axillary adipose tissue-derived lymphatic endothelial cells exhibit distinct transcriptomic signatures reflecting lymphatic invasion status in breast cancerBreast Cancer ResJune 17, 2025Asumi Iesato, Jun Suzuka, Kazutaka Otsuji, Tomo Osako, Nami Yamashita, Yuka Inoue, Tetsuyo Maeda, Natsue Uehiro, Kazuyo Yoshida, Yoko Takahashi, et al.6-well plate, and after 24 h, treated with or without 100 ng/mL recombinant human VEGF-C protein (cat#9199-VC-025, R&D Systems, USA) in the endothelial cell growth medium MV 2 with a penicillin–streptomycin antibiotic

(3) FLT4 activation promotes acute lymphoid leukemia survival through stabilization of MDM2/MDMX and inactivation of p53OncogenesisMay 2, 2025Haferssas D, Dubuissez M, Barrera-Chimal J, Messmer C, Affar EB, Larrivée B, Liu XS, Gerarduzzi C.

(4) Quantitative proteomics reveals CLR interactome in primary human cellsThe Journal of biological chemistryJune 1, 2024Manolis D, Hasan S, Maraveyas A, O'Brien DP, Kessler BM, Kramer H, Nikitenko LL.

(5) An EPHB4-RASA1 signaling complex inhibits shear stress-induced Ras-MAPK activation in lymphatic endothelial cells to promote the development of lymphatic vessel valvesbioRxiv : the preprint server for biologyNovember 23, 2023Chen D, Wiggins D, Sevick EM, Davis MJ, King PD.

(6) A 3D biomimetic model of lymphatics reveals cell-cell junction tightening and lymphedema via a cytokine-induced ROCK2/JAM-A complexProceedings of the National Academy of Sciences of the United States of AmericaOctober 10, 2023Lee E, Chan SL, Lee Y, Polacheck WJ, Kwak S, Wen A, Nguyen DT, Kutys ML, Alimperti S, Kolarzyk AM, et al.

(7) Zmiz1 is a novel regulator of lymphatic endothelial cell gene expression and functionbioRxiv : the preprint server for biologyJuly 22, 2023Rajan KC, Patel NR, Shenoy A, Scallan JP, Chiang MY, Galazo MJ, Meadows SM.

(8) pYtags enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cellseLifeMay 22, 2023Farahani PE, Yang X, Mesev EV, Fomby KA, Brumbaugh-Reed EH, Bashor CJ, Nelson CM, Toettcher JE.protein",PDGF-BB,Millipore Sigma,Cat # P3201, "Peptide, recombinant protein",VEGF-C,R&D Systems,Cat # 9199-VC-025, "Chemical compound, drug",Gefitinib,Cell Signaling Technology,Cat # 4765, "Chemical compound, drug",Hydrocortisone,Sigma-Aldrich,Cat

(9) Neuropilin-2 axis in regulating secretory phenotype of neuroendocrine-like prostate cancer cells and its implication in therapy resistanceCell reportsJuly 19, 2022Islam R, Mishra J, Polavaram NS, Bhattacharya S, Hong Z, Bodas S, Sharma S, Bouska A, Gilbreath T, Said AM, et al.ImmPACT DAB,Vector Laboratories,SK-4105 Recombinant human IL-8,R&D Systems,208-IL Recombinant VEGFC,R&D Systems,9199-VC-025 Halt phosphatase inhibitor,ThermoFisher Scientific,1862495 TRIzol Reagent,ThermoFisher Scientific,15596018 PowerSYBR

(10) Janus-faced EPHB4-associated disorders: novel pathogenic variants and unreported intrafamilial overlapping phenotypesGenetics in medicine : official journal of the American College of Medical GeneticsJuly 1, 2021Martin-Almedina S, Ogmen K, Sackey E, Grigoriadis D, Karapouliou C, Nadarajah N, Ebbing C, Lord J, Mellis R, Kortuem F, et al.cultured in supplemented endothelial growth medium MV2 (C-22022, PromoCell) containing 50 ng/ml VEGF-C (9199-VC-025, Bio-Techne). The cells are routinely analyzed by flow cytometric analysis and immunofluorescent staining:

(11) Coordinating Effect of VEGFC and Oleic Acid Participates to Tumor LymphangiogenesisCancersJune 8, 2021Morfoisse F, De Toni F, Nigri J, Hosseini M, Zamora A, Tatin F, Pujol F, Sarry JE, Langin D, Lacazette E, et al.

(12) S1PR1 regulates the quiescence of lymphatic vessels by inhibiting laminar shear stress-dependent VEGF-C signalingJCI insightJuly 23, 2020Geng X, Yanagida K, Akwii RG, Choi D, Chen L, Ho Y, Cha B, Mahamud MR, Berman de Ruiz K, Ichise H, et al.

(13) Spatiotemporal dynamics and heterogeneity of renal lymphatics in mammalian development and cystic kidney diseaseeLifeDecember 6, 2019Jafree DJ, Moulding D, Kolatsi-Joannou M, Perretta Tejedor N, Price KL, Milmoe NJ, Walsh CL, Correra RM, Winyard PJ, Harris PC, et al.at 12PCW "Peptide, recombinant protein",Vascular endothelial growth factor C,R and D Systems,Cat# 9199-VC-025,Added to culture medium at 40 ng/ml Sequence-based reagent,Pkd1RC_F,See Hopp et al. (2012),PCR primers,CAAAGGTCTGGGTGATAACTGGTG Sequence-based

(14) 6'-Sialylgalactose inhibits vascular endothelial growth factor receptor 2-mediated angiogenesisExperimental & molecular medicineOctober 11, 2019Chung TW, Kim EY, Choi HJ, Han CW, Jang SB, Kim KJ, Jin L, Koh YJ, Ha KT.

(15) Growth Factor Signaling Regulates Mechanical Nociception in Flies and VertebratesThe Journal of neuroscience : the official journal of the Society for NeuroscienceJuly 24, 2019Lopez-Bellido R, Puig S, Huang PJ, Tsai CR, Turner HN, Galko MJ, Gutstein HB.

(16) Matrix stiffness controls lymphatic vessel formation through regulation of a GATA2-dependent transcriptional programNature communicationsApril 17, 2018Frye M, Taddei A, Dierkes C, Martinez-Corral I, Fielden M, Ortsäter H, Kazenwadel J, Calado DP, Ostergaard P, Salminen M, et al.

(17) Arf6 in lymphatic endothelial cells regulates lymphangiogenesis by controlling directional cell migrationScientific reportsSeptember 12, 2017Lin YC, Ohbayashi N, Hongu T, Katagiri N, Funakoshi Y, Lee H, Kanaho Y.

(18) Heparanase-1-induced shedding of heparan sulfate from syndecan-1 in hepatocarcinoma cell facilitates lymphatic endothelial cell proliferation via VEGF-C/ERK pathwayBiochemical and biophysical research communicationsApril 1, 2017Yu S, Lv H, Zhang H, Jiang Y, Hong Y, Xia R, Zhang Q, Ju W, Jiang L, Ou G, et al.

(19) Alginate hydrogels allow for bioactive and sustained release of VEGF-C and VEGF-D for lymphangiogenic therapeutic applicationsPloS oneJanuary 1, 2017Campbell KT, Hadley DJ, Kukis DL, Silva EA.

Be the First to Write a Review!

Recombinant Human VEGF-C Protein

VEGF-C Protein

VEGF-C Protein

VEGF-C Protein from R&D Systems, a Bio-Techne Brand

Specifications/Features

R&D Systems, a Bio-Techne Brand

Citations (19)

Reviews

VEGF-C Protein from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map