T4 Polynucleotide Kinase M4103 from Promega

Product Specs
ItemT4 Polynucleotide Kinase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM4103
Size1,000u
SpeciesT4
Conjugate/TagUnconjugated
FormatConcentration: 5–10u/µl
ActivityOne unit is defined as the amount of enzyme required to catalyze the transfer of 1nmol of phosphate to the 5´-OH end of a polynucleotide from [?-32P]ATP in 30 minutes at 37°C. The reaction conditions are: 40mM Tris-HCl (pH 7.5 at 25°C), 10mM MgCl2, 5mM DTT, 0.1mM [?-32P] ATP and 0.5µg/µl 5´-OH polynucleotide end concentration.
Molecule NamePolynucleotide Kinase
Source/Expression SystemRecombinant, E.coli

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) The role of the VirB ligand CTP in the molecular mechanism of transcriptional anti-silencing in Shigella flexneriNucleic Acids ResearchFebruary 27, 2026Taylor M Gerson, Monika M A Karney, Helen J Wingethanol precipitation. DNA was single-end radiolabeled using T4 polynucleotide kinase (Promega Cat. No. M4101) using [γ32P] ATP (specific activity, 3000 Ci mmol–1; Perkin Elmer). Unincorporated radionucleotides

(2) Short internal open reading frames repress the translation of N-terminally truncated proteoformsEMBO ReportsFebruary 17, 2025Raphael Fettig, Zita Gonda, Niklas Walter, Paul Sallmann, Christiane Thanisch, Markus Winter, Susanne Bauer, Lei Zhang, Greta Linden, Margarethe Litfin, et al.AM2295 SUPERase·In RNase inhibitor,ThermoFisher Scientific,Cat# AM2696 T4 polynucleotide kinase,Promega,Cat# M4103 polyA polymerase,ThermoFisher Scientific,Cat# AM2030 DAPI,Thermo Fisher Scientific,Cat# 62248; CAS:

(3) The RNA helicase Dbp10 coordinates assembly factor association with PTC maturation during ribosome biogenesisNucleic Acids ResearchFebruary 28, 2024Valentin Mitterer, Hussein Hamze, Natalia Kunowska, Ulrich Stelzl, Anthony K Henras, Ed Hurthybridized to primer OHA612 (see below) radiolabelled at its 5′ end using T4 polynucleotide kinase (Promega, M4103) and [γ-32P] ATP (Perkin Elmer, NEG502Z). Primer extensions were performed for 1 h at 42°C using AMV reverse transcriptase

(4) Controlled Level of Contamination Coupled to Deep Sequencing (CoLoC-seq) Probes the Global Localisation Topology of Organelle TranscriptomesBIO-PROTOCOLSeptember 20, 2023Anna Smirnova, Damien Jeandard, Alexandre Smirnovstore at -20 °CPolynucleotide kinase (PNK) and 10× kinase reaction buffer A (Promega, catalog number: M4101); store at -20 °CChloroform (Carl Roth, catalog number: 6340.4)Isopropanol (Carl Roth, catalog number:

(5) Controlled Level of Contamination Coupled to Deep Sequencing (CoLoC-seq) Probes the Global Localisation Topology of Organelle TranscriptomesBio ProtocSeptember 20, 2023Anna Smirnova, Damien Jeandard, Alexandre Smirnovstore at -20 °CPolynucleotide kinase (PNK) and 10× kinase reaction buffer A (Promega, catalog number: M4101); store at -20 °CChloroform (Carl Roth, catalog number: 6340.4)Isopropanol (Carl Roth, catalog number:

(6) The Arabidopsis F-box protein FBW2 targets AGO1 for degradation to prevent spurious loading of illegitimate small RNACell ReportsApril 12, 2022Thibaut Hacquard et al.transcriptase,Fisher Scientific,4368813 Dnase I,Fisher Scientific,10649890 T4 Polynucleotide Kinase,Promega,M4103 T4 Polynucleotide Kinase,Thermo Fisher,EK0031 Glycogen,Thermo Fisher,R0561 Syringic acid,Sigma Aldrich,S6881 4-methylumbelliferyl-β-D-glucuronide,Duchefa,M1404 Pierce Anti-HA magnetic Beads

(7) The Small RNA ErsA Plays a Role in the Regulatory Network of Pseudomonas aeruginosa Pathogenicity in Airway InfectionsmSphereOctober 14, 2020Ferrara S, Rossi A, Ranucci S, De Fino I, Bragonzi A, Cigana C, Bertoni G.probes were 5′-end labeled with [γ-32P]ATP (PerkinElmer, NEG502A) and T4 polynucleotide kinase (Promega, M4103) according to the manufacturer’s instructions. Oligonucleotides CCCGAGCTTCGTATGGGG and GGAGACCCCACACTACCATCGGCGATG

(8) Lupus-associated endogenous retroviral LTR polymorphism and epigenetic imprinting promote HRES-1/RAB4 expression and mTOR activationJCI insightJanuary 16, 2020Godavarthy A, Kelly R, Jimah J, Beckford M, Caza T, Fernandez D, Huang N, Duarte M, Lewis J, Fadel HJ, et al.(Gamma-32, MP Biomedicals; catalog no. 0135020) and T4 polynucleotide kinase (Promega; catalog no. M4101) for 1 hour at 37°C and purified on Sephadex G-25 spin columns for use as EMSA probes (MilliporeSigma; GE Healthcare

(9) The m⁶A pathway protects the transcriptome integrity by restricting RNA chimera formation in plantsLife science allianceJune 1, 2019Pontier D, Picart C, El Baidouri M, Roudier F, Xu T, Lahmy S, Llauro C, Azevedo J, Laudié M, Attina A, et al.For At1g71340, the TL3417 primer (Table S7) was labeled using the T4 polynucleotide kinase (Cat. No. M4101; Promega) and used as in a probe in the PerfectHyb Plus Hybridization Buffer (Cat. No. H7033; Sigma-Aldrich)

(10) Insights into transcriptional silencing and anti‐silencing in Shigella flexneri : a detailed molecular analysis of the icsP virulence locusMolecular MicrobiologyJune 1, 2018Natasha Weatherspoon‐Griffin et al.strand, 4.8 pmol of each target was single-end labeled using T4 polynucleotide kinase (Promega Cat. No. M4101) according to manufacturer directions using [γ32P] ATP (specific activity, 3000 Ci mmol–1; Perkin Elmer).

(11) Importance of Validating Antibodies and Small Compound Inhibitors Using Genetic Knockout Studies—T Cell Receptor-Induced CYLD Phosphorylation by IKKε/TBK1 as a Case StudyFrontiers in Cell and Developmental BiologyApril 10, 2018Marie Lork, Marja Kreike, Jens Staal, Rudi Beyaertoligo (100 μM stock), 1 μl 10x T4 ligation buffer (M1804, Promega) and 1 μl T4 polynucleotide kinase (M4101, Promega) in a total volume of 10 μl in a thermocycler using the following parameters: 37°C for 30 min,

(12) The PAPI-1 pathogenicity island-encoded small RNA PesA influences Pseudomonas aeruginosa virulence and modulates pyocin S3 productionPLOS ONEJune 30, 2017Silvia Ferrara, Marilena Falcone, Raffaella Macchi, Alessandra Bragonzi, Daniela Girelli, Lisa Cariani, Cristina Cigana, Giovanni Bertoniprobes were 5'-end labeled with [γ-32P]ATP (PerkinElmer, NEG502A) and T4 polynucleotide kinase (Promega, M4103) according to manufacturer’s instruction. Oligo 1 and 2 were used to probe PesA and 5S RNA, respectively.

(13) Activation of PPARγ by baicalin attenuates pulmonary hypertension in an infant rat model by suppressing HMGB1/RAGE signalingFEBS open bioApril 1, 2017Chen Z, Wang Q.Oligonucleotide was labeled with [γ32P]ATP with the T4 polynucleotide kinase kit (Promega, Madison, WI, USA, no. M4101) as per the manufacturer's instructions. The binding was implemented with EMSA/Gel‐shift Binding Buffer

(14) A family of genus-specific RNAs in tandem with DNA-binding proteins control expression of thebadAmajor virulence factor gene inBartonella henselaeMicrobiologyOpenApril 1, 2017Nhan Tu, Ronan K. Carroll, Andy Weiss, Lindsey N. Shaw, Gael Nicolas, Sarah Thomas, Amorce Lima, Udoka Okaro, Burt Anderson(asBrtprobe, Table S6). The probe was labeled with [γ‐32P]ATP using T4 polynucleotide kinase (Promega, M4101). Unincorporated [γ‐32P]ATP was then removed using a QIAquick Nucleotide Removal Kit (Qiagen, 28304).

(15) A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory NeuropathiesPLOS GeneticsDecember 29, 2016Jocelyn Plassais et al.mutated sequence (Mut: 5’- TGTTGTCTTTGCTAC TGTCATGATGG-3’) were 5’-end labeled using T4-PNK (Promega M4101) and 20μCi of 32P-g ATP. Labeled oligonucleotides were purified on a Sephadex G-25 column. Unlabeled

(16) IMAGEtags: Quantifying mRNA Transcription in Real Time with Multiaptamer ReportersVisualizing RNA Dynamics in the CellJune 1, 2016Judhajeet Ray, Ilchung Shin, Muslum Ilgu, Lee Bendickson, Vinayak Gupta, George A. Kraus, Marit Nilsen-Hamiltonoligonucleotides by slow cooling from 95°C to 25°C and phosphorylate using T4 polynucleotide kinase (Promega, Cat# M4101).Ligate the double-stranded inserts into the digested vector with T4 DNA ligase (Promega, Cat# M1801)

(17) RNA regulatory networks diversified through curvature of the PUF protein scaffoldNature communicationsSeptember 14, 2015Wilinski D, Qiu C, Lapointe CP, Nevil M, Campbell ZT, Tanaka Hall TM, Wickens M.°C shaking every minute for 15 s. RNAs were labelled with 5 μl P32-γ-ATP, 50 units T4 PNK (Promega M4101) in 1 × PNK buffer at 37 °C for 10 min shaking every 5 min for 15 s. Ten microlitres of 10 mM ATP was

(18) Targeting of Repeated Sequences Unique to a Gene Results in Significant Increases in Antisense Oligonucleotide PotencyPLoS ONEOctober 15, 2014Timothy A. Vickers, Susan M. Freier, Huynh-Hoa Bui, Andrew Watt, Stanley T. CrookeThe RNAs were 5′-end labeled using 40 pmol of RNA, 20 U of T4 polynucleotide kinase (Promega, Cat# M4101), 120 pmol [γ-32P] ATP (6000 ci/mmol) (Perkin Elmer, Cat# NEG035C005MC), 70 mM Tris, pH 7.6, 10 mM MgCl2

(19) Transcriptional Regulation of Epidermal Barrier FormationMethods in Molecular BiologyApril 26, 2014Ambica Bhandari, Michael L. Salmans, William Gordon, Bogi Andersen250 μCi (Perkin Elmer; Cat. No. BLU502Z250UC).T4 polynucleotide Kinase and buffer (Promega; Cat. No. M4101) Store at −20°C.Loading Dye: 10 ml of 100% Glycerol, 2 ml of 0.5 M EDTA, 1% bromo-phenol blue.50 mM

(20) Defining the factors that contribute to on-target specificity of antisense oligonucleotidesPloS oneJanuary 1, 2014Lima WF, Vickers TA, Nichols J, Li C, Crooke ST.74104). RNAs were 5′-end labeled using 40 pmol of RNA, 20 U of T4 polynucleotide kinase (Promega, Cat# M4101), 120 pmol [γ-32P] ATP (6000 ci/mmol) (Perkin Elmer, Cat# NEG035C005MC), 70 mM Tris, pH 7.6, 10 mM MgCl2,

Be the First to Write a Review!

T4 Polynucleotide Kinase

T4 Polynucleotide Kinase from Promega

Description

Promega

Citations (21)

Reviews

T4 Polynucleotide Kinase from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map