T4 Polynucleotide Kinase M0201S from New England Biolabs

Product Specs
ItemT4 Polynucleotide Kinase
CompanyNew England Biolabs
Price $57.00 Inquire
Catalog NumberM0201S
Format10 u/µl
Molecule NamePolynucleotide Kinase
ActivityOne Richardson unit is defined as the amount of enzyme catalyzing the incorporation of 1 nmole of acid-insoluble [32P] in 30 minutes at 37°C.
Size500 units
ApplicationsDNA Manipulation
TypeEnzymes
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Site-specific inhibition of translation initiation via 2'-O-methylationNucleic Acids ResSeptember 28, 2026Adam Suh, Stephanie Mou, Emmely A Patrasso, Hannah Serio, Rui Wang, Yue Zhao, Kevin Vasquez, Smriti Sangwan, Yang Yi, Daniel Arangomono-phosphorylation of the 5′ end using 15 U of T4 Polynucleotide Kinase (New England Biolabs, Cat. #: M0201L) in the presence of ATP. Alternatively, in vitro transcribed RNAs were treated with RppH (New England Biolabs

(2) An Epstein-Barr virus-encoded snoRNA directs 2′-O-methylation of human rRNAs to control translation and the viral lytic switchCell ReportsSeptember 22, 2026Yarden Dan, Beáta E. Jády, Yudit Halperin, Yuval Nevo, Aliza Fedorenko, Anat Bashan, Maram Arafat, Pnina Glick, Ada Yonath, Tamás Kiss, et al.Superscript II Reverse Transcriptase,Invitrogen,18064–022 Antarctic Phosphatase,New England Biolabs,M0289S T4 Polynucleotide Kinase,New England Biolabs,M0201S ,, Critical commercial assays,Critical commercial assays,Critical commercial assays ,, NEBNext Small

(3) Ashwin and FAM98 paralogs define nuclear and cytoplasmic RNA ligase complexes for tRNA biogenesisNat CommunSeptember 17, 2026Moritz Kleinwächter, Marius Moser, Nathan Raynaud, Moritz M. Pfleiderer, Martin Jinek, Javier Martinez(NEB, B6004), 2 μL 10 mM ATP, 1 μL 100 mM DTT, 1 μL T4 DNA Ligase (NEB, M0202), 0.2 μL T4 PNK (NEB, M0201), 0.2 μL DpnI (NEB, R0176) and 11.6 μL nuclease-free water. The circularization reaction was performed

(4) Functional impact of Nth like DNA glycosylase 1 on mitochondrial dynamicsNucleic Acids ResSeptember 15, 2026Lisa Hubers, Alexander Myhr Skjetne, Luisa Luna, Yohan Lefol, Solveig Osnes Lund, Ane Marit Wågbø, Xavier Renaudin, Annikka Polster, Zoe J da Silva, Anders Knoph Berg-Eriksen, et al.uracil (U) at position 14, were 32P-labeled at the 5′ termini using T4 polynucleotide kinase (NEB, M0201S) and [γ-32P] ATP (3000 Ci/mmol) (Revvity, NEG502A250UC). They were subsequently annealed with their

(5) Resource-efficient Strand-seq library preparation in microliter volumes: a one-pot-style adaptation for standard laboratory infrastructureMethodsXSeptember 10, 2026Eva Benito, Ferris Jung, Catherine Stober, Patrick Hasenfeld, Maise Gomes Queiroz, Jan O. KorbelJ61125.06,2.4 100mM dATP,NEB N0440,3.57 10mM dNTP,NEB N0447L,1.78 T4 DNA polymerase⁎,NEB M0203L,3.22 T4 PNK⁎,NEB M0201L,10.77 Taq⁎,NEB M0273,1.99 H2O,Ambion AM9937,181.71 Total,,240 Polishing mastermix (96-well batch,

(6) A structural bridge between dengue virus tandem xrRNAs facilitates coordination of exonuclease resistancemBioSeptember 9, 2026Elizabeth Spear, Zoe O'Donoghue, Steve L. Bonilla, Kevin P. Larsen, Madeline E. Sherlock, Jeffrey S. KieftrRNA (sequence: 5′-ATGCGTTCAACGTGTCGG-3′) were radiolabeled via a T4 polynucleotide kinase (PNK; NEB M0201L) reaction with 2 μL 5 mCi [γ-32P]ATP (PerkinElmer). Sequence alignment and covariation model An initial

(7) A DNA-guided prokaryotic argonaute enables programmable RNA cleavage for sequencing and quality control of in vitro-transcribed RNAsMolecular Therapy Nucleic AcidsSeptember 8, 2026Lizhi Liu, Eric A. Hunt, Eric J. Wolf, Ivan R. Corrêa, Erbay Yigit, Sebastian Grünberghandler (Beckman Coulter) and phosphorylated using T4 polynucleotide kinase (New England Biolabs, #M0201S) according to the manufacturer’s protocols. For multiplexing experiments and when indicated, a 1x enhancer

(8) Conditional eIF2A Deletion Suggests Extra-Adipose Mechanisms Underlying Metabolic Syndrome in Total-Body eIF2A Knockout MiceFASEB BioadvSeptember 7, 2026Adedeji Isaac Adeloye, Richard Anderson, Anchal Agarwal, Barsanjit Mazumder, Taras Y. Nazarko, Atefeh Bagheri, Archana Prabahar, Peng Jiang, Frank Tedeschi, William C. Merrick, et al.instructions. The rRNA‐depleted RNA footprints were then dephosphorylated by adding 1 μL T4 PNK (NEB, Cat# M0201L), 1 μL SUPERase‐Inhibitor (Invitrogen, CA, USA, Cat# AM2696), and 7 μL of 10× PNK reaction buffer for

(9) Regulatory mechanisms of maternal imprinting at the murine Dlk1-Dio3 domainNat CommunSeptember 2, 2026Ariella Weinberg-Shukron, Frances L. Dearden, Ana Moreno-Barriga, Lok Ting Nick New, Marco Müller, Rebecca C. Rancourt, Carol A. Edwards, Anne C. Ferguson-Smithreverse), 1 mM ATP (New England Biolabs #P0756), 1× reaction buffer, and 0.5U T4 PNK (New England Biolabs #M0201). The reaction was incubated at 37 °C for 30′, 95 °C for 5′, and then cooled down to 25 °C at 0.1 °C/s.

(10) Dietary effects on cytosolic and mitochondrial tRNA abundance and modification patterns across mouse tissuesGenome ResearchSeptember 1, 2026Simeiyun Liu, Andrew D. Holmes, Ruoxia Zhao, Cassandra Herbert, Patrick A. Limbach, Todd M. Lowe, Upasna Sharmadeacylation of RNA sample for sequencing For PNK treatment, 1 µg of total RNA was treated with 5 U PNK (NEB M0201S) in 5× PNK buffer (350 mM Tris-HCl at pH 6.5, 50 mM MgCl2, 5 mM DTT) with 10 U RNase inhibitor (Invitrogen

(11) Puf3 contributes to changes in mRNA solubility, translation elongation dynamics at rare arginine codons and loss of protein homeostasis in cells lacking Not4RNASeptember 1, 2026Léna Audebert, George E. Allen, Siyu Chen, Olesya O. Panasenko, Susanne Huch, Christine Polte, Zoya O Ignatova, Vicent Pelechano, Martine A. CollartAUGUACACGGAGUCGAGCACCCG CAACGCGAAUG 3′). After dephosphorylation with the T4 Polynucleotide Kinase (NEB M0201S), the adapter Linker-1 (5′ rAppCTGTAGGCACCATCAAT/3ddC/3′) was ligated to the 3′ end of the RPF using

(12) A lysis-derived PMSF and orthovanadate oxidant defines a distinct cysteine-engagement profileCell Chemical BiologyAugust 31, 2026Bethany E. Schaffer, Jung Seung Nam, Ceci A. Cohen, Clementina Mesaros, Robert W. Myers, Leigh Baxt, Kathryn E. Wellen, Lewis C. Cantley, Noah Dephoure, Nathaniel W. Snyder, et al.forward and reverse sgRNA oligo (see Table S1 for sequences) and 0.5 μl T4 PNK (New England Biolabs, M0201) in 1x (1 μl) T4 ligation buffer (New England Biolabs, B0202) was incubated at 37°C to phosphorylate

(13) Assembly of exon junction complexes on spliceosomes begins before spliceosome activationNucleic Acids ResAugust 24, 2026Elizabeth T Abshire, Lynne E Maquatantisense). Each sense and antisense pair was annealed, phosphorylated at their 5′ end using T4 PNK (M0201S, New England Biolabs) and then ligated with BbsI-HF-digested (R3539S, New England Biolabs) pU6-(BbsI)-MYC-Cas9-T2A-mCherry

(14) Load-dependent RGD-context sensing via αV-class integrins reprograms cell adhesion and mechanicsNature CommunicationsAugust 24, 2026Upnishad Sharma, Jakob M. Reber, Jonne Helenius, Cara Buchholz, Reinhard Fässler, Nico Strohmeyer, Daniel J. Müllerreverse DNA oligomers encoding for the sgRNAs were phosphorylated by T4 polynucleotide kinase enzyme (#M0201S, New England BioLabs) treatment and then hybridized to form double stranded oligomers. Following a BpiI

(15) TTC33 forms a complex with WDR61 and PHF5A to recruit factors relevant to genomic integrityNature CommunicationsAugust 21, 2026Rafał Tomecki, Małgorzata Drabko, Małgorzata Siek, Maria Matykiewicz, Miłosz Ludwinek, Łukasz S. Borowski, Aneta Jurkiewicz, Kamil Kobyłecki, Agnieszka Jabłońska, Dominik Cysewski, et al.(TTC33/CCDC97 sgRNA 1–3). For each sgRNA, the respective construct was prepared by cloning annealed and T4 PNK (M0201S; New England Biolabs)-pre-phosphorylated top-strand (ts) and bottom-strand (bs) synthetic DNA oligonucleotides

(16) Stepwise DNA-unwinding gates TnpB genome-editing activityMolecular CellAugust 20, 2026Zehan Zhou, Iren Saffarian-Deemyad, Honglue Shi, Trevor Weiss, Muhammad Moez Ur-Rehman, Kamakshi Vohra, Petr Skopintsev, Peter H. Yoon, Marena I. Trinidad, Conner J. Langeberg, et al.for end-repair treatment with QuickCIP (New England Biolabs, M0525S) and T4 PNK (New England Biolabs, M0201S). RNA samples were incubated in a 20 μL reaction containing T4 PNK buffer (New England Biolabs, B0201S)

(17) A cofactor-promiscuous HMGR from the Lyme disease pathogen illuminates diversity in bacterial isoprenoid biosynthesisProtein SciAugust 19, 2026Isaac A. Paddy, Joshua McCausland, Madelyn Frazier, Poulami Chatterjee, Mekedlawit Setegne, Oliv Eidam, Christine Jacobs-Wagner, Laura M. K. Dassama5′‐AGTGATTAAAAAGAAAATCTTCAT‐3′ and 5′‐AACATGAAGATTTTCTTTTTAATC‐3′ were phosphorylated using T4 PNK (NEB M0201S) and ligated to SapI‐digested pBbdCas9S(RBSmut)‐Psyn‐sgRNA500 using T7 DNA ligase (NEB M0318S). The

(18) Reassessment of the roles of coronin proteins as actin effectors and in signalingPLoS BiolAugust 18, 2026Roko Gvozdenica Šipić, Haiyan Zhang, Andrii Kharin, Jerneja Koren, Viviana D'Otolo, Yuko Nariai, Takeshi Urano, Pawel Pelczar, Klemens Fröhlich, Alexander Schmidt, et al.sgRNA primers were first phosphorylated and annealed using the T4 polynucleotide kinase (NEB, CAT: M0201L). The annealed primers were and the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, plasmid CAT: 62988)

(19) Cross-species R-DeeP profiling reveals a conserved core of RNA-dependent proteins in yeastNucleic Acids ResAugust 13, 2026Nadine Bianca Wäber, Johanna Franziska Seidler, Fabienne Thelen, Palina Kot, Silke Schreiner, Thomas Timm, Günter Lochnit, Katja Sträßer, Cornelia KilchertTrypsin Gold, Mass spectrometry Grade (Promega, V5280), HaloTEV protease (Promega, G6601), T4 polynucleotide kinase (NEB, M0201S). Antibodies: rabbit IgG, whole molecule (ChromPure, 011-000-003), anti-TAP tag polyclonal antibody

(20) Compound delivery of eVLPs enhances prime editing for targeted genome engineering and high-throughput screeningCell GenomicsAugust 12, 2026Jethro Langley, Lou Baudrier, Jada Curry, Kiran Narta, Hayley M. Todesco, Kyle Potts, Sorana Morrissy, Douglas J. Mahoney, Pierre Billondescribed.80,81 Briefly, oligonucleotides were phosphorylated using T4 polynucleotide kinase (NEB, M0201) and annealed by heating to 95°C for 5 min followed by slow cooling to room temperature. Successful

Write a Review

(1)

4/19/2016T4 Kinase Kit Benjamin GerovacThis kit is used to add 5' phosphate groups to digested DNA so it can be ligated and cloned.

Genome- Scale Mapping of DNase I Hypersensitivity
July 01, 2013
In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes
January 01, 2012
In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization
October 01, 2009
Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis
October 01, 2007
Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries
July 01, 2001
Purification of Sequence- Specific DNA- Binding Proteins by Affinity Chromatography
October 01, 1993

T4 Polynucleotide Kinase

T4 Polynucleotide Kinase from New England Biolabs

Description

New England Biolabs

Citations (1878)

Reviews

Protocols

Genome- Scale Mapping of DNase I Hypersensitivity

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes

In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization

Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis

Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries

Purification of Sequence- Specific DNA- Binding Proteins by Affinity Chromatography

T4 Polynucleotide Kinase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map