T4 Polynucleotide Kinase M0201L from New England Biolabs

Product Specs
ItemT4 Polynucleotide Kinase
CompanyNew England Biolabs
Price $228.00 Inquire
Catalog NumberM0201L
Format10 u/µl
Size2500 units
Molecule NamePolynucleotide Kinase
ActivityOne Richardson unit is defined as the amount of enzyme catalyzing the incorporation of 1 nmole of acid-insoluble [32P] in 30 minutes at 37°C.
ApplicationsDNA Manipulation
TypeEnzymes
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) A DNA-guided prokaryotic argonaute enables programmable RNA cleavage for sequencing and quality control of in vitro-transcribed RNAsMolecular Therapy Nucleic AcidsSeptember 8, 2026Lizhi Liu, Eric A. Hunt, Eric J. Wolf, Ivan R. Corrêa, Erbay Yigit, Sebastian Grünberghandler (Beckman Coulter) and phosphorylated using T4 polynucleotide kinase (New England Biolabs, #M0201S) according to the manufacturer’s protocols. For multiplexing experiments and when indicated, a 1x enhancer

(2) Coordinated RNA- and protein-templated synthesis of double-stranded DNA by a dual reverse transcriptase immune systemCellAugust 6, 2026Megan Wang, Kanta Yoneyama, Rimantė Žedaveinytė, Junichiro Ishikawa, Stephen Tang, Hoang C. Le, Tanner Wiegand, Josephine L. Ramirez, Naoto Nagahata, Yanzhe Ma, et al.,Thermo Fisher Scientific,Cat#AM2238 RppH,New England Biolabs,Cat#M0356 T4 polynucleotide kinase,New England Biolabs,Cat#M0201 DNase I,New England Biolabs,Cat#M0303 Exonuclease I,New England Biolabs,Cat#M0568 MmeI,New England Biolabs

(3) Identification and structure determination of a type III-Bv CRISPR complex that post-translationally modifies an associated toxinStructureAugust 6, 2026Shishir Pandey, Nathaniel Burman, William S. Henriques, Tanner Wiegand, Trevor Zahl, Hannah Nyquist, Tanner Spreeuw, Murat Buyukyoruk, Blake WiedenheftI),Worthington Biochemical,CAT# LS003926 T4 Polynucleotide Kinase (T4 PNK),New England Biolabs,CAT# M0201S Q5 High-Fidelity DNA Polymerase,New England Biolabs,CAT# M0491S Quick CIP (Calf Intestinal Phosphatase),New England Biolabs

(4) Nascent chain folding status modulates ribosome dynamics and mRNA stability through the ribosome-associated chaperone Zuo1Mol CellAugust 6, 2026Suhee Chang, Ryan Kawalerski, Mehmet Tardu, Sophie Martin, Kristin S. Koutmou, Jeff Collerbuffer/temperature overnight with probes end-labelled with ɣ−32P-ATP using T4 Polynucleotide Kinase (NEB M0201S) (probes listed in Table S2). Blots were washed with 6X SSC, 0.1% SDS twice at room temperature for

(5) An optimized CRISPR/Cas9-based genome editing platform enhances bacteriocin production in Lactiplantibacillus plantarumJ Biol EngJuly 29, 2026Rajat Anand, Rudolf Lütticken, Laura De Laporte, Andreas Herrmann, Elisabeth HeineR3150S, R3189S, R0176S, R3133S, R3104S, respectively). T4 Polynucleotide Kinase (T4 PNK NEB, Cat. no. M0201S), shrimp alkaline phosphatase (rSAP, NEB Cat. no. M0371S) were used for the phosphorylation and dephosphorylation

(6) High-resolution chromatin mapping reveals that CTCF anchors meiotic loops to the chromosome axisNat CommunJuly 28, 2026Gang Cheng, Xin Li, Kevin Brick, Benjamin Alleva, Mini Huang, Kwan-Wood Gabriel Lam, Florencia Pratto, R. Daniel Camerini-Otero10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher, R0441), 2 μl T4 PNK (NEB, #M0201L), and 30 μl H2O) and incubating at 37 °C for 5 min. Then 8 μl 5 U/μL Klenow Fragment (NEB, M0210S) was

(7) APOE4 disrupts the central dogma by arresting neuronal proteome dynamicsbioRxivJuly 22, 2026Einar K. Krogsaeter, Justin McKetney, Lishi Li, Isabelle Liu, Alicia L. Richards, Vishvak Subramanyam, Keyi Yin, Martin Gordon, Pedro Belio Belio Mairal, Erica J. Stevenson, et al.Chemiluminescent Substrate,Fisher Scientific,#34577 T4 Polynucleotide Kinase (PNK),New England Biolabs,#M0201S Uridine,Sigma-Aldrich,#U3750-25G Y-27632 ROCK inhibitor,Tocris,#1254 ZapR Depletion Kit,Takara,#634370 Critical

(8) Quantitative profiling of basal and stress-induced ribosome collisionsbioRxivJuly 22, 2026James Marks, Pedro H Ayres-Galhardo, Bavavarshini Tamilselvam, Alexis Roberson, Ruby Pitts, Nicholas Guydosh, Sezen MeydanMonosome footprints, disome footprints, and size markers were first dephosphorylated with T4 PNK (NEB, M0201) for 1 hour at 37°C followed by linker ligation with truncated T4 RNA ligase 2 (NEB, M0351) to pre-adenylated

(9) Purine and pyrimidine-based bacterial cyclic dinucleotides egress the phagosome and activate the cytoplasmic innate immune sensor STINGImmunityJuly 17, 2026Stephanie A. Ragland, Katherine E. Lindblad, Yao Li, Joon H. Choi, Daniel Okin, Joshua Q. Mao, Desmond Richmond-Buccola, Daniela R. Coronado, Madison R. Brown, Scott B. Snapper, et al.antisense oligos were mixed with 1X T4 ligase buffer (NEB #B0202S) and 0.5μL T4 polynucleotide kinase (NEB #M0201S) for a total 10 μL reaction. The reaction mixture was incubated in a thermal cycler with the following

(10) Isotope-free mapping of protein-RNA interactions at single-nucleotide resolution by iCLIP3STAR ProtocJuly 17, 2026Vladimir Despic, Melina Klostermann, Anna Orekhova, Mikhail Mesitov, Anke Busch, Kathi Zarnack, Julian König, Michaela Müller-McNicoll,Thermo Fisher Scientific,Cat#AM2238 Recombinant RNasin Ribonuclease Inhibitor,Promega,Cat#N2511 T4 Polynucleotide kinase (T4 PNK),NEB,Cat#M0201S "T4 RNA Ligase 1 (ssRNA Ligase), High Concentration",NEB,Cat#M0437M 10X T4 RNA Ligase Reaction buffer,NEB,Component

(11) Robust regulatory interplay of enhancers, facilitators, and promoters in a native chromatin contextCellJuly 17, 2026Zhou Zhou, Yang Cheng, Jaret Lieberth, Junke Zhang, Yiyang Jin, Albert Li, Haiyuan Yu, Abdullah Ozer, John T. LisHigh Concentration",NEB,Cat#M0437M RNA 5’ Pyrophosphohydrolase (RppH),NEB,Cat#M0356S T4 PNK,NEB,Cat#M0201L TriZol Reagent,Thermo Fisher,Cat#15596018 TriZol LS Reagent,Thermo Fisher,Cat#10296028 SUPERase·In

(12) Queuosine tRNA modification regulates translational adaptation and virulence of Leishmania mexicanaPLoS BiolJuly 17, 2026Bankatesh Kumar, Julie Kovářová, Michala Boudová, Sneha Kulkarni, Thalia Pacheco Fernandez, Abhay Satoskar, Zdeněk Parisγ-32P ATP-labeled oligonucleotide probes were prepared using T4 Polynucleotide Kinase (NEB, Cat. No. M0201S) and purified using a Sephadex G-25 column. The probes were denatured at 98 °C for 5 min before being

(13) Predictive control of human pancreatic cell fate using a digital model of in vitro differentiationbioRxivJuly 16, 2026Enrique E. Sanchez-Castro, Matthew Ishahak, Tai Le, Marlie M. Maestas, Diana C. Hernandez-Rincon, Noyonika Mukherjee, Kameron Bradley, James Lu, Sarah E. Gale, Jeffrey R. MillmanForward and reverse primers (1 μL each), T4 ligation buffer (NEB, B0202A), T4 Polynucleotide Kinase (NEB, M0201S), and Ultrapure water were added to a PCR tube and placed in the thermocycler for phosphorylation and

(14) Genome-wide rotational and translational phasing of nucleosomes with human transcription factorsMol CellJuly 16, 2026Haining Chen, Jordan E. Krebs, Olivia W. Lang, Jiayi Hu, Devin C. Mellini, Judith Hyle, Chunliang Li, William K. M. Lai, B. Franklin PughLambda exonuclease,New England BioLabs,cat.no. M0262S T4 Polynucleotide Kinase,New England BioLabs,cat.no. M0201S T4 DNA ligase,New England BioLabs,cat.no. M0202S Phusion Plus DNA Polymerase,Thermo Scientific,cat.no.

(15) A simple and versatile fluorescence-based method to enhance prime editing in human pluripotent stem cellsBMC MethodsJuly 15, 2026Carlye Frisch, Salma Leyasi, William W. Kostes, Stefan J. Tekel, Kylie Standage-Beier, Gayathri Srinivasan, Xiao Wang, David A. BrafmanM0289)10x T4 DNA Ligase Reaction Buffer (NEB B0202)T4 DNA Ligase (NEB M0202)T4 Polynucleotide Kinase (NEB M0201)PCR Purification Kit (Qiagen 28106)Miniprep kit (Qiagen 27106)Maxiprep kit (Macherey-Nagel 740414.50)LB Broth

(16) OTTR-CLASH: improved biochemical and bioinformatic identification of Argonaute 2-mediated microRNA-target RNA interactionsbioRxivJuly 15, 2026Paul D. Kaufman, Haibo Liu, Kai Hu, Lucas Ferguson, Kathleen Collins, Lihua Julie Zhu, Thoru Pedersondephosphorylation using a combination of alkaline phosphatase (FastAP, Thermo, EF0651) and PNK (NEB M0201L, phosphatase-plus) was performed. Beads were resuspended in 50 ul FastAP reaction mix (1x Fast AP buffer

(17) Shared binding sites for the chromosomal architectural protein Su(Hw) mediate physical interactions between Drosophila TAD boundariesbioRxivJuly 15, 2026Wenfan Ke, Miki Fujioka, Brendan Wang, Tiffany Park, Li Zhang, Amina Kurbidaeva, Yuri Pritykin, James B Jaynes, Paul Schedlsolution,Sigma,95843 DSG (disuccinimidyl glutarate),Thermo Fisher,PI20593 T4 Polynucleotide Kinase - 500 units,NEB,M0201S "DNA Polymerase I, Large (Klenow) Fragment - 1000 units",NEB,M0210L End-it DNA End Repair Kit,Thermo

(18) CAD-C: An engineered nuclease enables repair-free in situ proximity ligation and nucleosome-resolution chromosome walks in human cellsbioRxivJuly 10, 2026Jan Soroczynski, Lauren Anderson Westcott, Wu Zuo, Arnold Ou, Hera Canaj, James Hickling, Joanna L. Yeung, Hide A. Konishi, Ellie B. Campbell, Conor Whelan, et al.100 mM DTT to each pellet (90 μL total), followed by 5 μL T4 polynucleotide kinase (10 U μL −1; NEB M0201L) and 10 μL DNA Polymerase I, Large (Klenow) Fragment (5 U μL −1; NEB M0210), giving a 105 μL reaction.

(19) Profiling of terminating ribosomes reveals translational control at stop codonsElifeJuly 7, 2026Longfei Jia, Yuanhui Mao, Saori Uematsu, Xinyi Ashley Liu, Leiming Dong, Leonardo Henrique França de Lima, Shu-Bing QianSigma,Cat# S7899-500ML, "Chemical compound, drug",T4 Polynucleotide Kinase,New England BioLabs,Cat# M0201L, "Chemical compound, drug",coli Poly(A) Polymerase,New England BioLabs,Cat# M0276L, "Chemical compound,

(20) A cofactor-promiscuous HMGR from the Lyme disease pathogen illuminates diversity in bacterial isoprenoid biosynthesisbioRxivJuly 7, 2026Isaac A. Paddy, Joshua McCausland, Madelyn Frazier, Poulami Chatterjee, Mekedlawit Setegne, Oliv Eidam, Christine Jacobs-Wagner, Laura M. K. DassamaAGTGATTAAAAAGAAAATCTTCAT -3’ and 5’- AACATGAAGATTTTCTTTTTAATC -3’ were phosphorylated using T4 PNK (NEB M0201S) and ligated to SapI-digested pBbdCas9S(RBSmut)-Psyn-sgRNA500 using T7 DNA ligase (NEB M0318S). The

Write a Review

(1)

4/19/2016T4 Kinase Kit Benjamin GerovacThis kit is used to add 5' phosphate groups to digested DNA so it can be ligated and cloned.

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes
January 01, 2012
In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization
October 01, 2009
Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis
October 01, 2007
Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries
July 01, 2001

T4 Polynucleotide Kinase

T4 Polynucleotide Kinase from New England Biolabs

Description

New England Biolabs

Citations (1827)

Reviews

Protocols

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes

In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization

Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis

Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries

T4 Polynucleotide Kinase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map