T4 Polynucleotide Kinase M0201L from New England Biolabs

Product Specs
ItemT4 Polynucleotide Kinase
CompanyNew England Biolabs
Price $228.00 Inquire
Catalog NumberM0201L
Size2500 units
Format10 u/µl
ActivityOne Richardson unit is defined as the amount of enzyme catalyzing the incorporation of 1 nmole of acid-insoluble [32P] in 30 minutes at 37°C.
ApplicationsDNA Manipulation
TypeEnzymes
Molecule NamePolynucleotide Kinase
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Arrayed dual-gRNA CRISPR Screening Platform for C9orf72 Repeat Expansion Excision in Patient iPSCsMolecular Therapy AdvancesJune 11, 2026Olubankole Aladesuyi Arogundade, Katie Jing Kay Kay Lam, Katherine A. Brown, Tanya Jain, Patrick O. Issagholian-Lewin, Cerianne Huang, Taylor Rae-Hudson, Kevin Briseno, Stacia K. Wyman, Netravathi Krishnappa, et al.SPRI-Guanidine beads, and treatment with USER enzyme (NEB M5505L) and T4 Polynucleotide Kinase (NEB M0201L). We then performed intramolecular circularization of DNA with T4 DNA ligase and degraded unwanted linearized

(2) Looping specificity of Polycomb response elements requires GAF and a combination of looping factors that could form a codeNucleic Acids ResMay 28, 2026Gonzalo Sabarís, Marco Di Stefano, Sandrine Denaud, Lauriane Fritsch, Ana-Maria Popmihaylova, Giorgio-Lucio Papadopoulos, Bernd Schuettengruber, Giacomo Cavalliand antisense oligonucleotides were annealed and phosphorylated by the T4 polynucleotide kinase (NEB #M0201S) before being inserted inside a pCFD3 plasmid (Addgene #49 410) previously digested by BbsI (NEB #R0539S).

(3) 53BP1 orchestrates sequence feature of RAG targets to balance DNA repair outcomes during V(D)J recombinationSci AdvMay 22, 2026Sha Luo, Hailiang Zha, Zifan Yang, Shuchan Li, Leyi Yu, Ruolin Qiao, Ruoxi Kong, Yifan Wang, Junhong Guan, Xuefei ZhangScientific, #65001), and the enriched run-on samples were incubated with end repair with T4 PNK (NEB, M0201S) and RppH (NEB, M0356S), followed by ligation the 5′ and 3′ RNA adaptors. Reverse transcription PCR

(4) Treacle-dependent TOPBP1 condensation regulates the nucleolar DNA damage responseNucleic Acids ResMay 19, 2026Nadezhda V Petrova, Dmitry A Deriglazov, Anastasia P Kovina, Artem V Luzhin, Victoria O Shender, Georgij P Arapidi, Alexey S Gavrikov, Alexander S Mishin, Sergey V Razin, Artem K Velichkosupplemented with 4 μl of T4 DNA polymerase (NEB M0203S, 3000 U/μl), 4 μl of T4 polynucleotide kinase (NEB M0201S, 10 000 U/μl), and 10 μl of 10 mM dNTPs. The reaction was carried out for 45 min at RT with gentle agitation.

(5) Engineering functionality-optimized fully human B7-H3 CAR T cells for enhanced solid tumor therapyCell Rep MedMay 19, 2026Pradip Bajgain, Yang Feng, Mariela Puebla, Meijie Tian, Kuo-Sheng Hsu, Jaewon Lee, GuoJun Yu, Liping Yang, Steven Seaman, Mary Beth Hilton, et al.(Integrated DNA Technologies). Oligonucleotides were phosphorylated with T4 polynucleotide kinase (PNK; NEB, M0201S), annealed at 95°C for 5 min, gradually cooled to room temperature, and ligated into BsmBI-digested

(6) An autochthonous CRISPR activation screening platform for characterizing tissue-specific oncogene selectionCell Reports MedicineMay 19, 2026Fredrik I. Thege, Amber Hoskins, Annaliese Kramer, Intisar Salim, Ashwath Seetharaman, Natalie Fowlkes, Kimal I. Rajapakshe, Anirban Maitra, Sonja M. Woermann11213857001 DNase I (bovine pancreas),Sigma,Cat# D5025-150KU 10X T4 ligase buffer,NEB,B0202S T4 PNK,NEB,M0201S T7 ligase,NEB,M0318S 2x StickTogether DNA Ligase Buffer,NEB,M0318S BsmBI-v2,NEB,R0739S KAPA HiFi HotStart ReadyMix

(7) The use of Benzonase to produce ribosome footprints simplifies translational levels quantification by Ribo-seqNAR Genom BioinformMay 15, 2026Guillermo Eastman, George S Bloom, José R Sotelo-Silveiradephosphorylated at 3′-ends by the action of 10 U of T4 Polynucleotide Kinase (New England Biolabs, Cat #M0201) in the presence of 1 mM of ATP for 30 min at 37°C. Ribosome footprints were then precipitated with

(8) Histone variant H2A.X represses deposition of active H3K4me3 marks and restricts H2A.W incorporationNucleic Acids ResMay 15, 2026Aravind Madhu, Vivek Hari-Sundar Gandhivel, Steffi Raju, Riju Dey, Padubidri V Shivaprasadand cross-linked using UV light. The membrane was hybridized with specific radiolabelled DNA [T4 PNK, M0201, New England Biolabs (NEB)] probes, which was amplified using polymerase chain reaction (PCR). Overnight

(9) 3' UTR-mediated regulation of a protein chaperone by the pspA mRNA in Streptococcus pneumoniaeNucleic Acids ResMay 14, 2026Jens S Pettersen, Anette Lund, Finn Kirpekar, Nikolaj V Hansen, Sine L Svenningsen, James C Paton, Jakob Møller-Jensen, Mikkel G Jørgensen(Supplementary Table S2) were 5′-labeled with 32P-ATP using T4-polynucleotide kinase (New England Biolabs, M0201). Membranes were pre-hybridized in hybridization buffer (PerfectHyb™ Plus, Sigma-Aldrich, H7033) for

(10) Generation of precise and accurate engineered circRNAs using enzymatic ligationNucleic Acids ResMay 8, 2026Amrita Singh, Adela Dujsikova, Noah Mueller, Y Grace Chenpurification and addition of monophosphate to transcripts using 10 units of T4 polynucleotide kinase (NEB #M0201L) at 37°C for 30 min. In the second approach, pyrophosphates were removed by using 10 units of pyrophosphatase

(11) Spatially Resolved in vivo CRISPR Screen Sequencing via Perturb-DBiTbioRxivMay 3, 2026Alev Baysoy, Xiaolong Tian, Feifei Zhang, Paul Renauer, Zhiliang Bai, Hao Shi, Haikuo Li, Bo Tao, Mingyu Yang, Archibald Enninful, et al.Bovine serum albumin,Sigma-Aldrich,A7030 DMEM,Gibco,NA Polybrene,Sigma,NA RPMI-1640,Gibco,NA DAPI Solution,Thermo Fisher Scientific,62248 T4 DNA Ligase,NEB,M0202L T4 Polynucleotide Kinase,NEB,M0201L Critical commercial assays,Critical commercial assays,Critical commercial assays D5000 ScreenTape

(12) Oxidative DNA lesions destabilize centromeres and drive chromosome instabilitybioRxivMay 1, 2026Lily Thompson, Rim Nassar, Annapaola Angrisani, Owen Ou Ning Hsiu, Yian Yang, Katarzina M Kedziora, Daniela Muoio, Daniele Fachinetti, Wayne Stallaert, Elise FouquerelR0137S HphI,NEB,Cat# R0158S MnlI,NEB,Cat # R0163S HinfI,NEB,Cat# R0155S T4 Polynucleotide Kinase,NEB,Cat# M0201S ,, Commercial Assays and Kits,, Senescence beta-galactosidase Staining kit,Cell Signaling,Cat# 9860 CellEvent™

(13) Uridine analogs prevent stress granule formation, not by blocking PKR recognition, but by inhibiting the synthesis of T7 RNA Polymerase byproductsRNAMay 1, 2026Sean J. Ihn, Emily Jiang, Nevraj S. KeJiou, Yifan E. Wang, Laura Farlam-Williams, Alexander F. Palazzo, Hyun O. LeeTCGAGTTTAATAGAAATTGGGACAGCAAGAAAGCGAGCTTACTGCAGGACGTA) with [γ32P]ATP (Revvity BLU035C001MC) using T4 polynucleotide kinase (NEB M0201S). Radiolabeled probes were purified using the MicroSpin G-25 Columns (Cytiva 27532501). Purified in vitro

(14) OT-Curtains: an approach for studying protein interactions with DNA ends using optical tweezers and confocal fluorescence microscopyNucleic Acids ResApril 28, 2026Sara De Bragança, Clara Aicart-Ramos, Ángel Rivera-Calzada, Raquel Arribas-Bosacoma, Mark S Dillingham, Oscar Llorca, Fernando Moreno-HerreroThe duplex was phosphorylated at the 5′ termini using T4 polynucleotide kinase (New England Biolabs, #M0201S) and inserted into the PciI site of the 2x poly-BbvCI plasmid. The recipient plasmid was digested with

(15) Ribosome Molecular Aging Shapes Translation DynamicsbioRxivApril 25, 2026Jordy F. Botello, Lifei Jiang, Peter J. Metzger, Troy J. Comi, Aya A. Abu-Alfa, Qiwei Yu, Margaret S. Ebert, Minkyu Lee, Lennard W. Wiesner, Maya Butani, et al.dephosphorylated in a 5 μL reaction containing 0.5 μL 10X T4 PNK buffer (NEB), 0.5 μL 10 U/μL T4 PNK enzyme (NEB, M0201L), and 0.5 μL SUPERase In RNase Inhibitor, incubated for 60 min at 37℃. Then, a 5 μL ligation reaction

(16) ADAR1 and ADAR2 associate with the RNA exosome and modulate RNA stabilityNucleic Acids ResApril 24, 2026Dragana Vukić, Qiupei Du, Anna Cherian, Damiano Amoruso, Květoslava Brožinová, Ludivine Wacheul, Valentina Lacovich, Christiane Zorbas, Leena Yadav, Jiří Sedmík, et al.GGGGCGATTGATCGGCAAGCGACGCTC; or LD1827: CCTCGCCCTCCGGGCTCCGTTAATGATC) was generated with T4 polynucleotide kinase (NEB, M0201S) according to the manufacturer’s protocol. Membranes were hybridized with the probe for 1 h at 65°C,

(17) PALINCODE: Recording cell lineage with ternary palindromic CRISPR bitsbioRxivApril 19, 2026Maryam Fathi, Aidan Cook, Bagheri Bagheri, Tyler Curiel, Aaron McKennathen annealed and phosphorylated each pair using NEB 10x T4 ligation buffer (#B0202) and NEB T4 PNK (#M0201), incubated 30 min at 37 °C, 5 min at 95 °C, and then ramped down to 25 °C at 5 °C/min. Each insert

(18) Mechanistic dissection of BLTP2 targeting to ER-PM contact sitesbioRxivApril 17, 2026Sarah D. Neuman, Amy T. Cavanagh, Nicole Sheffels, Elizabeth Conibear, Arash BashirullahDpnI (New England Biolabs R0176), phosphorylated with T4 Polynucleotide Kinase (New England Biolabs M0201), and ligated back into pGEM T-easy with T4 DNA Ligase (New England Biolabs M0202). Subsequently, pGEM

(19) RNA virus polymerase-helicase coupling enables rapid elongation through duplex RNACell ReportsApril 16, 2026Pim P.B. America, Subhas C. Bera, Arnab Das, Thomas K. Anderson, John C. Marecki, Flávia S. Papini, Jamie J. Arnold, Robert N. Kirchdoerfer, Craig E. Cameron, Kevin D. Raney, et al.Polyphosphatase,Biosearch technologies,RP8092H T4 Polynucleotide Kinase,New England Biolabs,Cat # M0201 T4 RNA ligase 2,New England Biolabs,Cat # M0239 Ulp1 peptidase,Byrd et al.39,N/A Phosphocellulose

(20) RNA-binding protein LARP6 coordinates hepatic stellate cell activation and liver fibrosisJournal of Clinical InvestigationApril 15, 2026Hyun Young Kim, Orel Mizrahi, Wonseok Lee, Sara B. Rosenthal, Cuijuan Han, Brian A. Yee, Steven M. Blue, Jesiel Diaz, Jyotiprakash P. Jonnalagadda, Lena A. Street, et al.with FastAP Thermosensitive Alkaline Phosphatase (Thermo, EF0651) and T4 polynucleotide kinase (NEB, M0201S). The RNA was ligated with a 3′ adaptor ligated using T4 ligase, and reverse transcribed with SuperScript III First-Strand Synthesis SuperMix

Write a Review

(1)

4/19/2016T4 Kinase Kit Benjamin GerovacThis kit is used to add 5' phosphate groups to digested DNA so it can be ligated and cloned.

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes
January 01, 2012
In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization
October 01, 2009
Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis
October 01, 2007
Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries
July 01, 2001

T4 Polynucleotide Kinase

T4 Polynucleotide Kinase from New England Biolabs

Description

New England Biolabs

Citations (1752)

Reviews

Protocols

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes

In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization

Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis

Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries

T4 Polynucleotide Kinase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map