RsaI from New England Biolabs

Product Specs
ItemRsaI
CompanyNew England Biolabs
Price $67.00 Inquire
Catalog NumberR0167S
Concentration10 u/µL
Quantity1000 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

GT/AC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) A Multi-Locus and Machine Learning-Based Assessment of SNCA Variants in Alzheimer's DiseaseInt J Mol SciJune 5, 2026Hatice Segmen, Mustafa YildizUpon digestion with RsaI (recognition site: GT↓AC; New England Biolabs, Ipswich, MA, USA; Cat. No. R0167), the C allele yielded two fragments of 267 bp and 121 bp, while the T allele yielded three fragments

(2) Yap1 regulates motility and vertebral development and prevents kyphoscoliosis in zebrafishPLOS GeneticsMay 28, 2026Victoria C. Williams-Ward, Kees Wanders, Simon M. Hughesprimers GGGCACCAGAAGGCCTATTG and GGTTGTATGTGTAAGGGTCAGT GTC annealed at 59°C, digested with RsaI (NEB, R0167) at 37°C for 4 hours to over-night yielding cut wild-type bands (250 and 396 bp), uncut mutant band

(3) Telomere Dysfunction in Human Astrocytes Drives Acrocentric Chromosome Instability and Nucleolar ReorganizationbioRxivMay 25, 2026Ogechukwu Mbegbu, Yi-An Chen, Yue Hao, Noelle Fukushima, T. Rhyker Ranallo-Benavidez, Ava Bryan, Szehoi Chan, Nikki Messick, Maria Kyriakidou, Tianpeng Zhang, et al.digested overnight (~12 h) at 37°C with HinfI (New England Biolabs, R0155S) and RsaI (New England Biolabs, R0167L). The resulting DNA fragments were resolved on a 0.7% agarose gel in 1× TAE buffer.Electrophoresis of

(4) Redescription and embryonic developmental dynamics of Aphelenchoides bicaudatus with implications for nematode taxonomy and ecologyiScienceMay 15, 2026Min Li, Ying Pei, Yanmei Shi, Fengmao Chen, Lifeng Zhourecombinant proteins","Chemicals, peptides, and recombinant proteins" ,, RsaI,New England Biolabs,Cat# R0167 HaeIII,New England Biolabs,Cat# R0108 MspI,New England Biolabs,Cat# R0106 HinfI,New England Biolabs,Cat#

(5) Telomere Dysfunction and Proteostasis Decline Define Distinct Pathways of Cellular Senescence in the Human Respiratory TractAging CellApril 20, 2026Céline Coquette, Kamar Bouchoucha, Manon Mahieu, Stijn E. Verleden, Axelle Loriot, Kevin Norris, Duncan M. Baird, Amélie Derumier, Delphine Hoton, Laurens De Sadeleer, et al.2019), using 5 μg of RNase‐treated genomic DNA digested with 20 U HinfI (R0155S, NEB) and 20 U RsaI (R0167L, NEB) and a [γ‐32P] ATP (BLU502A250UC, Revvity)‐labeled (TAACCC)4 probe (Eurogentec). Smart Ladder (MW‐1700‐10,

(6) Local heterochromatin enrichment promotes telomere clustering and PML nuclear body assembly at telomeresCell ReportsMarch 24, 2026Erin R. Taylor, Bruce Proctor, Melina Vaurs, Guanhui Wu, Manon Mahieu, Shreya Shrestha, Daniel Morrison, Laila Weatherly, Shane Brelinsky, Maya Raghunandan, et al.deionized water. 5μg of DNA was digested with 20 units of HinfI (NEB, #R0155L) and 20 units of RsaI (NEB, #R0167) in 1x Cutsmart buffer at 37°C for 2 h and purified with phenol-chloroform as described above. 10 ng

(7) Public Spaces as Hotspots of Zoonotic Gastrointestinal Parasite Transmission: Evidence from Small Animal and Soil Surveillance in MalaysiaJournal of Epidemiology and Global HealthJanuary 16, 2026Suey Yee Low, Sze Kee Gun, Sadiq Mohammed Babatunde, Sharifah Salmah Syed Hussain, Wan Nur Ismah Wan Ahmad Kamil, Abdul Rahman Omar, Azalea Hani Othman, Tengku Rinalfi Putra Tengku Azizan, Maizatul Akmal Moktar, Noraain binti Azman, et al.subjected to digestion of HinF1 (catalog number: R0108S, New England Biolabs) and RSaI (catalog number: R0167S, New England Biolabs) to differentiate its species [40]. In brief, ten microlitres of PCR product were

(8) Dna2 nuclease resolves RNA:DNA hybrids at double-strand breaksiScienceJuly 30, 2025Aditya Mojumdar, Courtney Granger, Martine Lunke, Ellis Evans, Jennifer A. CobbK,Invitrogen,25530031 Raffinose,US Biological,R1030 RNase A,Sigma,R6513 RsaI,New England Biolabs,R0167S SDS,Avantor,409502 Sodium Acetate,VWR,BDH9278 Sodium Chloride,Fisher Chemical,S64212 Tris base,Fisher

(9) Telomere length as a biomarker for cumulative experience in broiler chickensPLoS OneJune 25, 2025Andrew M. Campbell, Mallory G. Anderson, Mark F. Haussmann, Raquel Rowell, Leonie Jacobsquantified using both assays. For the TRF assay, 10 µg quantity of DNA was digested using 1.0 µL of RsaI (R0167L, New England Biolabs, Ipswich, MA, USA) and 0.2 µL of HinfI (R0155M, New England Biolabs) in CutSmart Buffer

(10) Systemic in utero gene editing as a treatment for cystic fibrosisProceedings of the National Academy of SciencesJune 17, 2025Adele S. Ricciardi, Christina Barone, Rachael Putman, Elias Quijano, Anisha Gupta, Richard Nguyen, Hanna Mandl, Alexandra S. Piotrowski-Daspit, Francesc Lopez-Giraldez, Valerie Luks, et al.a mixture containing 2 μL NEBuffer1, 2.8 μL water, and 0.2 μL Rsa I (10 U/μL; New England BioLabs, #R0167S) was prepared and added to the tube containing the PCR product. The restriction digest reaction was

(11) cGAS-STING are responsible for premature aging of telomerase-deficient zebrafishThe EMBO JournalJune 9, 2025Naz Şerifoğlu, Giulia Allavena, Bruno Lopes-Bastos, Marta Marzullo, Andreia Marques, Pauline Colibert, Pavlos Bousounis, Eirini Trompouki, Miguel Godinho Ferreira,Sigma Aldrich,R6513 Chloroform,Sigma Aldrich,C2432 Phenol:chloroform:isoamyl alcohol,Sigma Aldrich,77617 RSAI,New England Biolabs,R0167 HINFI,New England Biolabs,R0155 [alpha-32P]-dCTP,Revvity,BLU513H250UC MS-222,Sigma Aldrich,E10521 TrypLE,Gibco,12604021 Penicillin/Streptomycin,Sigma Aldrich

(12) Comprehensive benchmarking of genome editing quantification methods for plant applicationsiScienceApril 29, 2025Zheng Gong, Yan Zhang, Di Xia, Sohye Yoon, Peter Alexander Crisp, José Ramón Botella,New England Biolabs,R0574S BglII,New England Biolabs,R0144S MfeI-HF,New England Biolabs,R3589S RsaI,New England Biolabs,R0167S BsrDI,New England Biolabs,R0574S HpaI,New England Biolabs,R0105S BstNI,New England Biolabs,R0168S NuSieve

(13) Morphological and molecular identification of Toxocara isolated from road-killed golden jackals in Northern IranBMC Vet ResFebruary 24, 2025Amirhosain Roohi Koshalshah, Meysam Sharifdini, Mohammad Saleh Bahreini, Amir Masoud Salemi, Syed Mohammad Kifayatullah Andrabi, Syeda Sadaf Mehdi, Fattaneh Mikaeiliwere digested with restriction endonuclease RsaI (New England BioLab Inc., New England Biolabs (NEB), R0167S) at 37 °C for 3 h. The digested PCR amplicons were electrophoresed on a 2% agarose gel at 80 V for 1

(14) Mural cell dysfunction contributes to diastolic heart failure by promoting endothelial dysfunction and vessel remodellingCardiovasc DiabetolFebruary 7, 2025Mandy O. J. Grootaert, Alessandra Pasut, Jana Raman, Steven J. Simmonds, Bram Callewaert, Ümare Col, Mieke Dewerchin, Peter Carmeliet, Stephane Heymans, Elizabeth A. V. Jonesand 72 °C for 1 min, with final extension at 72 °C for 10 min. Next, 1 µl of RsaI restriction enzyme (R0167, NEB) was added to the PCR product and incubated at 37 °C for 15 min (no heat inactivation needed).

(15) Cell Type Specific Suppression of Hyper-Recombination by Human RAD18 Is Linked to Proliferating Cell Nuclear Antigen K164 UbiquitinationBiomoleculesJanuary 20, 2025Colette B. Rogers, Wendy Leung, Ryan M. Baxley, Rachel E. Kram, Liangjun Wang, Joseph P. Buytendorp, Khoi Le, David A. Largaespada, Eric A. Hendrickson, Anja-Katrin Bielinskygenomic DNA was digested with HinfI (NEB, Ipswich, MA, USA; R0155) and RsaI (NEB, Ipswich, MA, USA; R0167) restriction enzymes, as described [44]. For each sample, 8 to 12 μg of digested genomic DNA was resolved

(16) Proteasome-mediated degradation of long-range nucleases negatively regulates resection of DNA double-strand breaksiScienceJuly 19, 2024Marco Gnugnoli, Carlo Rinaldi, Erika Casari, Paolo Pizzul, Diego Bonetti, Maria Pia Longheseproteins","Chemicals, peptides, and recombinant proteins" ,, SspI-HF,NEB,Cat#R3132L RsaI,NEB,Cat#R0167L KpnI-HF,NEB,Cat#R3142S Hygromycin B,Roche,Cat#10843555001 G-418 disulfate,Merck,Cat#A1720 Methyl

(17) A persistent variant telomere sequence in a human pedigreeNature CommunicationsJune 1, 2024Angela M. Hinchie, Samantha L. Sanford, Kelly E. Loughridge, Rachel M. Sutton, Anishka H. Parikh, Agustin A. Gil Silva, Daniel I. Sullivan, Pattra Chun-On, Matthew R. Morrell, John F. McDyer, et al.μM. The reaction was incubated for 5 min at 60 °C and then 15 min at 65 °C. 1 μl of each RsaI (NEB #R0167S) and HinfI (NEB # R0155S) were added to the reaction and it was incubated at 37 °C overnight. The DNA

(18) Validation of human telomere length multi-ancestry meta-analysis association signals identifies POP5 and KBTBD6 as human telomere length regulation genesNature CommunicationsMay 24, 2024Rebecca Keener, Surya B. Chhetri, Carla J. Connelly, Margaret A. Taub, Matthew P. Conomos, Joshua Weinstock, Bohan Ni, Benjamin Strober, Stella Aslibekyan, Paul L. Auer, et al.(Thermo Fisher). Approximately 1 μg of genomic DNA was restricted with HinfI (R0155M; NEB) and RsaI (R0167L; NEB) and resolved by 0.8% Tris-acetate-EDTA (TAE) agarose gel electrophoresis. 10 ng of a 1kB Plus

(19) Birds of a feather age together: telomere dynamics and social behavior predict life span in female Japanese quail (Coturnix japonica)Front Endocrinol (Lausanne)May 14, 2024Shannon E. McCollum, Olivia Canter, Vincent J. Fasanello, Sarah Gronsky, Mark F. Haussmannusing the TRF assay. A 10 μg quantity of DNA was digested using 1.0 ml of RsaI (New England Biolabs, R0167L) and 0.2 ml of HinfI (New England Biolabs, R0155M) in CutSmart Buffer (New England Biolabs, B7204S)

(20) BLM helicase unwinds lagging strand substrates to assemble the ALT telomere damage responseMolecular CellMay 2, 2024Haoyang Jiang, Tianpeng Zhang, Hardeep Kaur, Tao Shi, Aravind Krishnan, Youngho Kwon, Patrick Sung, Roger A. Greenbergof genomic DNA were digested with HinfI (New England Biolabs, R0155S) and RsaI (New England Biolabs, R0167L) overnight at 37°C. The digested DNA was subjected to electrophoresis with the CHEF-DRII system (Bio-Rad).

Be the First to Write a Review!

RsaI

RsaI from New England Biolabs

Sequence

New England Biolabs

Citations (56)

Reviews

RsaI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map