Mouse TNF alpha ELISA Kit ab46105 from Abcam

Product Specs
ItemMouse TNF alpha ELISA Kit
CompanyAbcam
Price Supplier Page View Company Product Page
Catalog Numberab46105
Quantity1 x 96 Tests, 2 x 96 Tests
ApplicationssELISA, ELISA
Detection Range31.25 - 1000 pg/ml
MethodELISA
SensitivityLess than 25 pg/mL
Gene NameTNF
NCBI Gene AliasesDIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f
Research AreaImmunology & Infectious Disease
NCBI Full Gene Nametumor necrosis factor

Add to Compare List

Abcam

Discovery Drive

Cambridge Biomedical Campus

Cambridge CB2 0AX

United Kingdom

Phone: +44 (0) 1223 696000 (option 1)
+44 (0) 1223 696000 (option 2)
+44 (0) 1223 771600

Company Profile

Website: http://www.abcam.com

(1) Indole-3-carbinol ameliorates ER stress-mediated hyperleptinemia in western diet-fed apoE-/- miceFood & Nutrition ResearchFebruary 11, 2026Hyun Ju Kim(MAK106-1KT) was determined using a kit from Sigma-Aldrich (St. Louis, MO, USA). IL-6 (04-BI-IL6), TNF-α (ab46105), and leptin (22-LEPMS-E01) levels were measured using commercial ELISA kits from Abcam (Cambridge,

(2) Cholesterol-induced colorectal cancer progression and its mitigation through gut microbiota remodeling and simvastatin treatmentBMC CancerJune 1, 2025Xiaoliang Xie, Wenjing Wang, Haiming Zhang, Shaohui Zhao, Na Zhang, Ying Gao, Quanxia Liu, Xiaomei Chencholesterol (LDL-C) (#MBS748297); interleukin- 2 (IL-2) (ab100706; Abcam); tumor necrosis factor-α (TNF-α) (ab46105; Abcam); and TNF-β (ab100689; Abcam). It was measured at 450 nm on an enzyme labeling instrument (BioTek). Cell

(3) Myeloid SENP3 deficiency protects mice from diet and age-induced obesity via regulation of YAP1 SUMOylationCell Mol Life SciDecember 9, 2023Yangjing Jiang, Min Liang, Long Chen, Jian Wang, Yijie Huang, Huanhuan Huo, Danrui Xiao, Yunwen Hu, Zi Wang, Qingqi Ji, et al.were measured with enzyme-linked immunosorbent assay (ELISA) kits (Abcam, Cat# ab197742, ab46100, and ab46105, respectively), according to the manufacturer's instructions. Statistical analysis Statistical analyses

(4) Sevoflurane preconditioning prevents acute renal injury caused by ischemia-reperfusion in mice via activation of the Nrf2 signaling pathwayExperimental and therapeutic medicineApril 1, 2022Wang WX, Zhao ZR, Bai Y, Li YX, Gao XN, Zhang S, Sun YB.ELISA kit (cat. no. ab119601; Abcam). Serum inflammatory cytokine levels, including TNF-α (cat. no. ab46105), IL-6 (cat. no. ab222503), and IL-1β (cat. no. ab197742) were also measured using ELISA kits (all purchased

(5) Role of adipocyte Na,K-ATPase oxidant amplification loop in cognitive decline and neurodegenerationiScienceNovember 19, 2021Sodhi K, Pratt R, Wang X, Lakhani HV, Pillai SS, Zehra M, Wang J, Grover L, Henderson B, Denvir J, et al.,ThermoFisher Scientific,Cat# KMB3481 Mouse IL-6 ELISA Kit,Abcam,Cat# Ab100712 Mouse TNFa ELISA Kit,Abcam,Cat# Ab46105 Protein Carbonyl ELISA Assay Kit,BioCell Corporation,Cat# BPCK01 RNeasy Protect Mini Kit,Qiagen,Cat#

(6) Do proinflammatory cytokines play a role in clozapine-associated glycometabolism disorders?Psychopharmacology (Berl)July 1, 2021Tongtong Zhao et al.from Abcam (Cambridge, UK). Insulin values are presented in μlU/ml. ELISA kits (ab197742, ab222503, and ab46105) for detection of the proinflammatory cytokines IL-1β, IL-6, and TNF-α were obtained from Abcam (Cambridge,

(7) A Novel Indoline Derivative Ameliorates Diabesity-Induced Chronic Kidney Disease by Reducing Metabolic AbnormalitiesFront Endocrinol (Lausanne)March 10, 2020Anna Permyakova, Asaad Gammal, Liad Hinden, Michal Weitman, Marta Weinstock, Joseph Tamfollowing markers (MCP1, TNFα, TGFβ, and IL18) were measured using ELISA kits (Abcam; Cat# ab100721, ab46105, ab119557, and ab216165, respectively). Liver proteins were extracted and the levels of TNFα were measured

(8) Effects of Farnesiferol B on Ischemia-Reperfusion-Induced Renal Damage, Inflammation, and NF-κB SignalingInternational Journal of Molecular SciencesDecember 12, 2019Lu Zhang, Xianjun Fu, Ting Gui, Tianqi Wang, Zhenguo Wang, Gerd A. Kullak-Ublick, Zhibo Gai(ab65340, Abcam, Cambridge, UK), Mouse MCP1 ELISA Kit (ab100721, Abcam), Mouse TNF alpha ELISA Kit (ab46105, Abcam), and LTB4 Parameter Assay Kit (KGE006B; R&D Systems, Minneapolis, MN, USA), respectively. Kidney

(9) Artesunate exerts protective effects against ulcerative colitis via suppressing Toll‑like receptor 4 and its downstream nuclear factor‑κB signaling pathwaysMolecular medicine reportsAugust 1, 2019Chen YX, Zhang XQ, Yu CG, Huang SL, Xie Y, Dou XT, Liu WJ, Zou XP.R&D Systems China Co., Ltd., Shanghai, China), IFN-γ (cat. no. ab46107; Abcam) and TNF-α (cat. no. ab46105, Abcam) were measured using their respective ELISA kits, according to the protocols recommended by the

(10) Root Extract of Polygonum cuspidatum Siebold & Zucc. Ameliorates DSS-Induced Ulcerative Colitis by Affecting NF-kappaB Signaling Pathway in a Mouse Model via Synergistic Effects of Polydatin, Resveratrol, and EmodinFrontiers in PharmacologyApril 11, 2018Baohai Liu et al.of IL-1β (Cat. No. ab197742), IL-6 (Cat. No. ab100713), IL-10 (Cat. No. ab46103) and TNF-α (Cat. No. ab46105) were measured by using ELISA kits from Abcam (Cambridge, MA, United States). One-gram small intestine

(11) Acylated and unacylated ghrelin inhibit apoptosis in myoblasts cocultured with colon carcinoma cellsOncology ReportsJanuary 12, 2018Xianliang Zeng, Sizeng Chen, Yanfeng Lin, Zhao KeATACG GCTACAGCAA‑3' and 5'‑GCAGCGAACTTTATTGATGGT ATT‑3'. ELISA. A Mouse TNF alpha ELISA kit (ab46105), Mouse IL‑1 beta ELISA kit (ab100704) (both from Abcam), and Mouse IFN‑gamma Quantikine ELISA kit (MIF00; R&D Systems

(12) 1-Deoxynojirimycin (DNJ) Ameliorates Indomethacin-Induced Gastric Ulcer in Mice by Affecting NF-kappaB Signaling PathwayFrontiers in pharmacologyJanuary 1, 2018Piao X, Li S, Sui X, Guo L, Liu X, Li H, Gao L, Cai S, Li Y, Wang T, et al.indomethacin induction were regarded as the CG group. n = 8 in each group. ab100713) and TNF-α (Category No. ab46105) were measured by using ELISA kits from Abcam. GA, United States), and Human, Mouse, Rat VIP ELISA

(13) Probiotic mixture improves fatty liver disease by virtue of its action on lipid profiles, leptin, and inflammatory biomarkersBMC Complementary and Alternative MedicineDecember 1, 2017Hessah Mohammed Al-muzafar, Kamal Adel Aminle Bretonneux France). IL-6 and TNF-α ELISA detection kits were purchased from Abcam (ab100712 and ab46105). Experimental design and animal grouping The experiments lasted 16 weeks and were divided in two

(14) Acylated and unacylated ghrelin inhibit atrophy in myotubes co-cultured with colon carcinoma cellsOncotargetSeptember 22, 2017Zeng X, Chen S, Yang Y, Ke Z.2−ΔΔCT method. The RT-qPCR primer sequences used are listed in Table 1. ELISA Mouse TNF alpha (Abcam, ab46105), mouse IL-1 beta (Abcam, ab100704), and GDF-8/Myostatin Quantikine (R&D Systems, Minneapolis, MN, USA,

(15) Organic acid component from Taraxacum mongolicum Hand.-Mazz alleviates inflammatory injury in lipopolysaccharide-induced acute tracheobronchitis of ICR mice through TLR4/NF-?B signaling pathwayInternational ImmunopharmacologyFebruary 22, 2016Nan Yang, Chao Li, Gang Tian, Maomao Zhu, Weiquan Bu, Juan Chen, Xuefeng Hou, Liuqing Di, Xiaobin Jia, Zibo Dong, Liang Feng

(16) Attenuation of the cardiovascular and metabolic complications of obesity in CD14 knockout miceLife SciencesSeptember 26, 2008Roberto Roncon-Albuquerque, Mónica Moreira-Rodrigues, Bernardo Faria, Andrea P. Ferreira, Cátia Cerqueira, André P. Lourenço, Manuel Pestana, Pedro von Hafe, Adelino F. Leite-Moreiracultures at the end of the 120 min incubations, according to the manufacturer's instructions (Abcam ab46105). Statistical analysis Data are presented as mean ± SEM. To assess the effect of genotype and diet for

Be the First to Write a Review!

BMC Cancer

Mouse TNF alpha ELISA Kit from Abcam

Abcam

Citations (16)

Reviews

Mouse TNF alpha ELISA Kit from Abcam

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map