TGFα (134 A) Antibody sc-36 from Santa Cruz Biotechnology, Inc.

Product Specs
ItemTGFα (134 A) Antibody
CompanySanta Cruz Biotechnology, Inc.
Price $316.00Supplier Page View Company Product Page
Catalog Numbersc-36
NCBI Gene Aliaseswa-1, wa1, TFGA
Antibody TypePrimary Antibodies
Reactivitymouse, rat, human
Quantity100 µg/ml
Clone134 A
ApplicationsWB, IP, IF
FormatPurified
Conjugate/TagUnconjugated
ClonalityMonoclonal
Hostmouse
NCBI Full Gene Nametransforming growth factor alpha
TargetTGFalpha
IsotypeIgG1

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Toxoplasma gondii-Derived Soluble Factors Induce G2/M Phase Accumulation and p53-Associated Mitochondrial Apoptosis in Human Umbilical Cord Mesenchymal Stem CellsJ Cell Mol MedAugust 16, 2026Wei Zhou, Tingyu Chen, Ziping Yang, Jinjing Huang, Xinyi Lai, Jie Liu, Jiaqi Chu, Juanhua Quanor p53 siRNA (sc‐29,435) using siRNA Transfection Reagent (sc‐29,528) and siRNA Transfection Medium (sc‐36,868; Santa Cruz Biotechnology, Dallas, TX, USA) according to the manufacturer's instructions. Briefly,

(2) Autophagy regulates cellular senescence by mediating the degradation of CDKN1A/p21 and CDKN2A/p16 through SQSTM1/p62-mediated selective autophagy in myxomatous mitral valve degenerationAutophagyJuly 1, 2025Tang Q, Tang K, Markby GR, Parys M, Phadwal K, MacRae VE, Corcoran BM.× 106) were transfection with a total amount of 1 µM human RPS6KB1 siRNA (Santa Cruz Biotechnology, sc -36,165), human ATG7 siRNA (Santa Cruz Biotechnology, sc -41,447), human ATG3 siRNA (Santa Cruz Biotechnology,

(3) RPN1 promotes the proliferation and invasion of breast cancer cells by activating the PI3K/AKT/mTOR signaling pathwayDiscover OncologyFebruary 1, 2024Wei-juan Shen, Yi Zhanggrow to 50–60% confluence. To generate RPN1 knockdown cell models, RPN1 shRNA lentiviral particles (sc-36,420-V, Santa Cruz) or control shRNA lentiviral particles (sc108060, Santa Cruz) were transfected into

(4) S100A family is a group of immune markers associated with poor prognosis and immune cell infiltration in hepatocellular carcinomaBMC cancerJuly 7, 2023Qi Y, Zhang Y, Li J, Cai M, Zhang B, Yu Z, Li Y, Huang J, Chen X, Song Y, et al.medium supplemented with 10% fetal bovine serum (FBS, Corning) at 37 °C and 5% CO2. Si-S100A10 (cat. no. sc-36,338, Santa Cruz Biotechnology) and scrambled siRNA (si-NC, cat. no. sc-37,007, Santa Cruz Biotechnology)

(5) Glucagon-like peptide-1 receptor regulates receptor of advanced glycation end products in high glucose-treated rat mesangial cellsJournal of the Chinese Medical AssociationJanuary 4, 2023Jui-Ting Chang, Yao-Jen Liang, Jyh-Gang Leuwas described previously.14 RMCs were transfected with 800-ng PPARδ annealed siRNA oligonucleotide (sc-36 306) or siRNA of green fluorescent protein (GFP). PPARδ siRNA is a pool of three target-specific 20

(6) Glucagon-like peptide-1 receptor regulates receptor of advanced glycation end products in high glucose-treated rat mesangial cellsJ Chin Med AssocNovember 8, 2022Jui-Ting Chang, Yao-Jen Liang, Jyh-Gang Leuwas described previously.14 RMCs were transfected with 800-ng PPARδ annealed siRNA oligonucleotide (sc-36 306) or siRNA of green fluorescent protein (GFP). PPARδ siRNA is a pool of three target-specific 20

(7) Endothelin-1-mediated miR-let-7g-5p triggers interlukin-6 and TNF-α to cause myopathy and chronic adipose inflammation in elderly patients with diabetes mellitusAgingApril 25, 2022Tsai CH, Huang PJ, Lee IT, Chen CM, Wu MH.p-IKKα/β (Ser180/Ser181; SC-23470-R), IKKα/β(SC-7607), p-IκBα (Ser32; SC-8404), IκBα (SC-203), PCNA(SC-36), and β-actin (SC-58673), and C6 ceramide (an ERK activator), were all purchased from Santa Cruz (Santa

(8) Role of sirtuin 1 in the brain development in congenital hypothyroidism rats via the regulation of p53 signaling pathwayBioengineeredApril 1, 2022Wei X, Tan J, Gao H.sc-437,275; Santa Cruz Biotechnology, Inc.), 0.2 µM control-small interfering RNA (siRNA; cat. no. sc-36,869; Santa Cruz Biotechnology, Inc.) or 0.2 µM SIRT1-siRNA (cat. no. sc-40,986; Santa Cruz Biotechnology, Inc

(9) MicroRNA-193b impairs muscle growth in mouse models of type 2 diabetes by targeting the PDK1/Akt signalling pathwayDiabetologiaMarch 1, 2022Yang S, Yang G, Wu H, Kang L, Xiang J, Zheng P, Qiu S, Liang Z, Lu Y, Jia L.luciferase reporter constructs (Pdk1 3′-UTR or Pdk1 3′-UTR-mutant), miRNA (control RNA [catalogue no.: sc-36,869; Santa Cruz Biotechnology] or miR-193b-3p) and Renilla luciferase using Lipofectamine 3000 (Invitrogen).

(10) Prevotellaceae produces butyrate to alleviate PD-1/PD-L1 inhibitor-related cardiotoxicity via PPARα-CYP4X1 axis in colonic macrophagesJournal of experimental & clinical cancer research : CRJanuary 3, 2022Chen Y, Liu Y, Wang Y, Chen X, Wang C, Chen X, Yuan X, Liu L, Yang J, Zhou X.PPARα siRNA transfection experiment was performed as previously described [22]. siRNA targeting PPARα (sc-36,308) was obtained from Santa Cruz Biotech, Inc. (Dallas, TX, USA), and transfection was performed using

(11) The antidiabetic drug metformin acts on the bone microenvironment to promote myeloma cell adhesion to preosteoblasts and increase myeloma tumour burden in vivoTranslational oncologyJanuary 1, 2022Gámez B, Morris EV, Olechnowicz SWZ, Webb S, Edwards JR, Sowman A, Turner CJ, Edwards CM.siRNA, control siRNA and control siRNA-fluorescein conjugate were used for transient transfection (sc-36,130, sc-37,007, sc-36,869, Santa Cruz Biotechnology). 4 µl of RNAiMAX lipofectamine (13,778,075, Thermo

(12) Long noncoding RNA small nucleolar RNA host gene 12/microRNA-138-5p/nuclear factor I/B regulates neuronal apoptosis, inflammatory response, and oxidative stress in Parkinson's diseaseBioengineeredDecember 1, 2021Yan L, Li L, Lei J.RiboBio Inc.), miR-138-5p mimic (5′‐AGCUGGUGUUGUGAAUCAGGCCG‐3′; RiboBio Inc.), control-siRNA (cat. no. sc-36,869; Santa Cruz Biotechnology), and NFIB-siRNA (cat. no. sc-43,561; Santa Cruz Biotechnology) were transfected

(13) RNA sequencing and functional studies of patient-derived cells reveal that neurexin-1 and regulators of this pathway are associated with poor outcomes in Ewing sarcomaCellular oncology (Dordrecht)October 1, 2021Roundhill EA, Chicon-Bosch M, Jeys L, Parry M, Rankin KS, Droop A, Burchill SA.(X-005, Nucleofector™ 2b Device (Amaxa, Lonza, UK) with an siRNA scrambled control (siControl, 50 nM, sc-36,869, Santa Cruz Biotechnology, Inc) or siRNA targeting neurexin-1 (siNRXN1, 50 nM, sc-42,050, a pool

(14) S6K1 Is Indispensible for Stress-Induced Microtubule Acetylation and Autophagic FluxCellsApril 17, 2021Hać A, Pierzynowska K, Herman-Antosiewicz A.#sc9996), and hemagglutinin (HA)-tag (#sc-7392), as well as control (#sc-37007) and S6K1targeting siRNAs (#sc-36-165; a mixture of three different target-specific siRNAs), were form Santa Cruz Biotechnology (Dallas,

(15) Gm14230 controls Tbc1d24 cytoophidia and neuronal cellular juvenescencePloS oneJanuary 1, 2021Morimune T, Tano A, Tanaka Y, Yukiue H, Yamamoto T, Tooyama I, Maruo Y, Nishimura M, Mori M.LS-C679739, 1:200, Washington, US), Vimentin (Santa Cruz, sc-6260, 1:100, Texas, US), Impdh (Santa Cruz, sc-36-5171, 1:100, ProteinTech, 129481-AP, 1:100), Cpts1 (ProteinTech, 15914-1-AP, 1:200 and LSBio, LS-C197001,

(16) Valproic acid upregulates the expression of the p75NTR/sortilin receptor complex to induce neuronal apoptosisApoptosis : an international journal on programmed cell deathOctober 1, 2020Dedoni S, Marras L, Olianas MC, Ingianni A, Onali P.control siRNA-A (sc-37,007), human HDAC1 siRNA (sc-29,343), human CASZ1 siRNA (sc-78,956) or human p75NTR siRNA (sc-36,051) (Santa Cruz Biotechnology) duplexes using Lipofectamine RNAiMAX (Invitrogen-Thermo Fisher Scientific)

(17) Strong selective effects of mitochondrial DNA on the nuclear genomeProceedings of the National Academy of SciencesMarch 24, 2020Timothy M. Healy, Ronald S. Burtonintertidal splash pools near San Diego, California (SD: 32° 45′ N, 117° 15′ W) and Santa Cruz, California (SC: 36° 56′ N, 122° 02′ W) and were split into 200-mL laboratory cultures in glass beakers Healy and Burton containing

(18) Pinocembrin Ameliorates Cognitive Impairment Induced by Vascular Dementia: Contribution of Reelin-dab1 Signaling PathwayDrug design, development and therapyJanuary 1, 2020Kang ZC, Wang HG, Yang YL, Zhao XY, Zhou QM, Yang YL, Yang JY, Du GH.16-Nov-2021 For personal use only. Kang et al siRNA reagent system from Santa Cruz Biotechnology, sc36,868), the cells were incubated with Reelin siRNA (Santa Cruz Biotechnology, sc-42,208) for 6 hours.

(19) Caffeine May Abrogate LPS-Induced Oxidative Stress and Neuroinflammation by Regulating Nrf2/TLR4 in Adult Mouse BrainsBiomoleculesNovember 8, 2019Badshah H, Ikram M, Ali W, Ahmad S, Hahm JR, Kim MO.anti-PSD-95(sc-71,933), anti-TNF-α (sc-52,746), TLR4 (sc-16240), anti-Bax(sc-7480), anti-Bcl2 (sc-7382), anti-p-NF-kB (sc-36,548), anti-Iba-1 (sc-32,725), anti-Glial fibrillary acidic protein (GFAP; sc-33,673), and anti-β-actin

(20) Puma genomes from North and South America provide insights into the genomic consequences of inbreedingNature CommunicationsOctober 18, 2019Nedda F. Saremi, Megan A. Supple, Ashley Byrne, James A. Cahill, Luiz Lehmann Coutinho, Love Dalén, Henrique V. Figueiró, Warren E. Johnson, Heather J. Milne, Stephen J. O’Brien, et al.of inbreeding. Results Genome assembly and variant calling. We assembled a de novo nuclear genome for a wild male puma (SC36) from the Santa Cruz Mountains using a combination of shotgun Illumina (47× coverage), long-range linking

Be the First to Write a Review!

TGFα (134 A) Antibody

TGFα (134 A) Antibody from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (44)

Reviews

TGFα (134 A) Antibody from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map