Human TIMP-3 ELISA Kit EH458RB from Thermo Fisher Scientific

Product Specs
ItemHuman TIMP-3 ELISA Kit
CompanyThermo Fisher Scientific
Price Supplier Page
Catalog NumberEH458RB
Quantity96 Tests
ApplicationsSandwich ELISA Kit
Detection Range0.12-25 ng/mL
ReactivityHuman
Sample TypePlasma, 50 µL; Serum, 50 µL; Supernatant, 50 µL
SensitivityInterAssay Sensitivity: <12%%; IntraAssay Sensitivity: <10%%
Detection TargetTIMP3
Assay TimeHands-On Time: 1 hr 20 minTime to Results: 4 hr 45 min
NCBI Full Gene NameTIMP metallopeptidase inhibitor 3
NCBI Gene AliasesHSMRK222, SFD, K222TA2, K222
Research AreaAngiogenesis, Apoptosis, Blood, Cancer, Inflammation

Add to Compare List

Thermo Fisher Scientific

81 Wyman Street

Waltham, MA 02451

United States

Phone: 800-678-5599
Fax: 800-331-2286

Company Profile

Website: www.thermofisher.com

(1) Statistical analysis supports pervasive RNA subcellular localization and alternative 3' UTR regulationeLifeDecember 19, 2024Bierman R, Dave JM, Greif DM, Salzman J.replicates. ELISA measurements were made using the Human TIMP-3 ELISA Kit from Invitrogen (Catalog # EH458RB) and precisely following the manufacturer’s instructions. >Proximal_primer_1_fwd GGGAACTATCCTCCTGGCCC

(2) CD200 is overexpressed in the pancreatic tumor microenvironment and predictive of overall survivalCancer immunology, immunotherapy : CIIApril 15, 2024Wedig J, Jasani S, Mukherjee D, Lathrop H, Matreja P, Pfau T, D'Alesio L, Guenther A, Fenn L, Kaiser M, et al.human MMP3 (R&D Systems, DMP300), Human MMP11 (LSBio, LS-F21105-1), and human TIMP3 (Thermo Fisher, EH458RB) ELISA kits which were run according to the manufacturer’s instructions. The median sCD200 level was

Be the First to Write a Review!

ELISA

Human TIMP-3 ELISA Kit from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (2)

Reviews

Human TIMP-3 ELISA Kit from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map