Luna Cell Ready One-Step RT-qPCR Kit E3030S from New England Biolabs

Product Specs
ItemLuna Cell Ready One-Step RT-qPCR Kit
CompanyNew England Biolabs
Price $1,066.00 Inquire
Catalog NumberE3030S
Quantity100 reactions
ApplicationsDNA Analysis, RT-qPCR
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Genotype-by-Inhibitor Interactions to Dissect Enterovirus ReplicationResearch SquareSeptember 30, 2025Patrick Bakhache, William Symonds-Orr, Patrick T. Symonds-Orrtargeting the 5’ UTR of the virus or the GAPDH gene using the Luna Cell Ready One-Step RT-qPCR Kit (NEB, E3030S). Primers for amplifying the 5’UTR region of the virus were GCCCCTGAATGCGGCTAATC (forward) and GGACACCCAAAGTAGTCGGTTC

(2) A subcellular sampling instrument allows spatial resolution of amyloid deposit-derived organelle-specific effects in microgliaCommun BiolJanuary 3, 2025Robert Subirana Slotos, Tinh Thi Nguyen, Ledjona Fiska, Kristina Friedland, Kristina Endreswere combined with the Cell lysis mix (Luna ® Cell Ready One-Step RT-qPCR Kit, New England Biolabs, E3030S), excluding DNAseI, resulting in a total volume of 40 μL. 32 μL were transferred into a new vial and

Be the First to Write a Review!

Luna Cell Ready One-Step RT-qPCR Kit

Luna Cell Ready One-Step RT-qPCR Kit from New England Biolabs

New England Biolabs

Citations (2)

Reviews

Luna Cell Ready One-Step RT-qPCR Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map