pGEM-T Vector System I from Promega

Product Specs
ItempGEM-T Vector System I
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3600
HostBacteria
ResistanceAmpicillin
Vector NamepGEM®-T Vector
MCSApa I, Aat II, Sph I, BstZ I, Nco I, Sac II, Spe I, Not I, BstZ I, Pst I, Sal I, Nde I, Sac I, BstX I, Nsi I
PromoterT7 and SP6 RNA polymerase promoters
Origin of Replicationf1 Origin of Replication
Quantity20 reactions
Selectable Markerß-galactosidase

Specifications/Features

Kit Contents:
Includes:

• 1.2µg pGEM®-T Vector (50ng/µl)
• 12µl Control Insert DNA (4ng/µl)
• 100u T4 DNA Ligase
• 200µl 2X Rapid Ligation Buffer, T4 DNA Ligase
• 1 Protocol

Features:
• Rapid Ligation: The 2X Rapid Ligation Buffer provided allows reactions to be completed in 1 hour at room temperature.
• Blue/White Screening: T7 and SP6 RNA polymerase promoters flank a multiple cloning region within the a-peptide coding region for ß-galactosidase. Insertional inactivation of the a-peptide allows recombinant clones to be directly identified by color screening on indicator plates.
• f1 Origin of Replication: Allows the preparation of single-stranded DNA.

Vector Size:
3,000 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) A single-nucleotide enhancer mutation overrides chromosomal sex to drive XX male developmentNat CommunApril 9, 2026Elisheva Abberbock, Meshi Ridnik, Isabelle Stévant, Roni Weiss, Carmel Bamberger, Shelly Ziv Lhermann, Maor Lubman, Yumi Minyi Yao, Ariel Afek, Francis Poulat, et al.DECODR. For samples carrying sequential mutations within the same allele, TA cloning (Promega pGEM®-T, A3600) was performed to resolve the mutation structure. The purified 616 bp Enh13 PCR fragment was ligated

(2) Directionality bias in T/A cloningMicroPubl BiolApril 6, 2026Valeria Dountcheva, Athanasios Bubulya, Labib RouhanaGoTaq 2-Step RT-qPCR System,Promega,A6010 GoTaq® Long PCR Master Mix,Promega,M4021 pGEM®-T Vector Systems,Promega,A3600 TRIzol™ Reagent,Thermo Fisher Scientific,15596026 "Schmidtea mediterranea, hermaphrodite strain","Phillip

(3) Host-transposon mutualism supports regeneration in planariansDevelopmental CellMarch 30, 2026Hae-Lim Lee, Axel Poulet, Sudheesh Allikka Allikka Parambil, Josien C. van Wolfswinkelpaper,see Supplementary Table S1 Recombinant DNA,Recombinant DNA,Recombinant DNA pGEM-T,Promega,Cat#A3600 pCDNA 3.1,ThermoFisher,Cat#V790-20 pCMV3flag8HOIL-1L,Fu et al. 121,Addgene Cat#50016 pGEX-XIAP,Yang

(4) Drift of positional identity drives reproductive aging in a long-lived regenerative animalCurr BiolMarch 23, 2026Andrew Verdesca, Axel Poulet, Maxwell Bales, Josien C. van Wolfswinkel55 For all others, this paper; see supplementary table S1.",N/A Recombinant DNA,, pGEM-T,Promega,A3600 pGEM-unc22,"Li et al, 2021 55",N/A pGEM-notum,This paper,N/A pGEM-wnt1,This paper,N/A pGEM-wnt5,This

(5) A conserved mammalian mecciRNA, mecciATP6, regulates mitochondrial homeostasis through interaction with HNRNPA3Noncoding RNA ResMarch 19, 2026Xiaoyang Cao, Juzheng Sui, Ge Shan, Xu Liufrom Thermo Scientific (FD series). Ligation reactions were performed using T4 DNA ligase (Promega, A3600), and recombinant cloning was carried out using a seamless cloning kit (Vazyme, C112-02). All plasmids

(6) NRMLncR, a myocyte-enriched long non-coding RNA, enhances myogenesis in mousebioRxivFebruary 17, 2026Yufen Li, Yumei Zhou, Qing Ying Li, Justine Arrington, Mostafa F. Abdelhai, Yubo Wang, Junxiao Ren, Yung-Yu Cheng, Mingyi Xie, W. Andy Tao, et al.antisense NRMLncR. Briefly, sense and antisense NRMLncR DNA was cloned into pGEM-T vector (Promega, cat#A3600) with primers shown in Supplemental Table 1, linearized and purified. Biotinylated sense and antisense

(7) Directionality bias in T/A cloningbioRxivFebruary 16, 2026Valeria Dountcheva, Athanasios Bubulya, Labib RouhanaGoTaq 2-Step RT-qPCR System,Promega,A6010 GoTaq® Long PCR Master Mix,Promega,M4021 pGEM®-T Vector Systems,Promega,A3600 TRIzol™ Reagent,Thermo Fisher Scientific,15596026 "Schmidtea mediterranea, hermaphroditic strain","Phillip

(8) A Replication-Competent Flavivirus Genome with a Stable GFP Insertion at the NS1-NS2A JunctionBiology (Basel)January 24, 2026Pavel Tarlykov, Bakytkali Ingirbay, Dana Auganova, Tolganay Kulatay, Viktoriya Keyer, Sabina Atavliyeva, Maral Zhumabekova, Arman Abeev, Alexandr V. Shustovprimers targeting NS1-GFP-NS2A. The resulting amplicons were cloned into the pGEM-T vector (Promega Cat. A3600). The plasmid clones were sequenced, ensuring that each part in the NS1-GFP-NS2A region was covered

(9) Dorsoventral limb patterning in paired appendages emerged via regulatory repurposing of an ancestral posterior fin moduleMolecular Biology and EvolutionJanuary 3, 2026Sofía Zdral, Simone Giulio Bordignon, Axel Meyer, Marian A Ros, Joost M Wolteringfrom further permission under German law. Cloning of probes Probes were cloned into pGEMT (Promega A3600) vector using a PCR template from synthesized embryonic cDNA or gDNA of A. burtoni, A. baerii, S. canicular,

(10) Biosynthesis of glucosaminyl phosphatidylglycerol in Pseudomonas aeruginosaJournal of BacteriologyDecember 18, 2025Fabiha Zaheen Khan, Kelli L. Palmer, Ziqiang Guanµg/mL gentamicin. Escherichia coli DH5α (Thermo Fisher Scientific) with the plasmid pGEM-T (Promega PR-A3600) was grown in LB broth containing 50 µg/mL ampicillin. Complementation of the gpgD transposon mutant

(11) Segregation of endoderm and mesoderm germ layer identities in the diploblast Nematostella vectensisNat CommunAugust 27, 2025Emmanuel Haillot, Tatiana Lebedeva, Julia Steger, Grigory Genikhovich, Juan D. Montenegro, Alison G. Cole, Ulrich Technauprimers listed in Supplementary Table 1. PCR products were cloned into the pGEM-T vector (Promega, A3600). FITC or DIG-labeled RNA probes were generated by in vitro transcription with SP6 or T7 polymerase.

(12) TERT PfeRNA regulates telomere length during cellular senescence of normal human bronchial epithelial cellsSci RepJuly 1, 2025Suguru Yamauchi, Kaitlyn Ecoff, Andrei Gurau, Kristen P. Rodgers, Malcolm V. Brock, Yuping Meibands were purified following our reported method. pGEM®-T Vector Systems (Promega Corporation, Cat# A3600), high-efficiency NEB 5-alpha competent E. coli (New England Biolabs, Cat# C2987I), and LB agar plates

(13) Functional characterization of eicosanoid signaling in Drosophila developmentPLoS GenetMay 9, 2025Daiki Fujinaga, Cebrina Nolan, Naoki Yamanakain S13 Table. For absolute quantification of mRNAs, serial dilutions of pGEM-T plasmids (Promega, #A3600) containing coding sequences of the target genes were used as standards. Transcript levels were normalized

(14) Regulatory roles of an sRNA derived from the 5´ UTR and sequence internal to lap A in Pseudomonas aeruginosa PAO1Microbiology SpectrumApril 22, 2025Xiaojuan Tan, Jingjing Xiao, Qianqian Liu, Ting Yang, Dandan Feng, Ruyi Zheng, Liping Luo, Xi Cheng, Dongsheng Du, Minghui Li, et al.The final PCR products were subsequently cloned and inserted into the pGEM-T vector system (Promega, #A3600) before Sanger sequencing. The specific primers used in the RACE assays are listed in Table S4. Construction

(15) Wdr5-mediated H3K4 methylation facilitates HSPC development via maintenance of genomic stability in zebrafishProceedings of the National Academy of SciencesMarch 25, 2025Xiaohan Wang, Mengyao Liu, Yifan Zhang, Dongyuan Ma, Lu Wang, Feng Liureported methods (67). First, the DNA templates of probes were cloned into the pGEM-T vector (Promega, A3600). The RNA probes labeled with Digoxigenin (Roche, 11277073910) were synthesized by T7/Sp6 RNA polymerase

(16) Interplay between CTCF-binding and CTCF-lacking regulatory elements in generating an architectural stripe at the Igh locusNat CommunMarch 3, 2025Fei Ma, Noah Ollikainen, Hansen Du, Fatima Zohra Braikia, Nina Cui, Aisha Haley Bianchi, Christopher Dunn, Cuong Nguyen, Jinshui Fan, Supriyo De, et al.different steps. Step one: 4.3 kb DNA fragment covering Eµ was inserted into pGEM®-T Vector (Promega, #A3600). Step two: 1.2 kb EF1α promoter DNA fragment was amplified from plasmid pHIV-Zsgreen (Addgene, #18121).

(17) Functional characterization of eicosanoid signaling in Drosophila developmentbioRxivJanuary 13, 2025Daiki Fujinaga, Cebrina Nolan, Naoki Yamanakain S13 Table. For absolute quantification of mRNAs, serial dilutions of pGEM-T plasmids (Promega, #A3600) containing coding sequences of the target genes were used as standards. Transcript levels were normalized

(18) Loss of carbohydrate sulfotransferase 6 function leads to macular corneal dystrophy phenotypes and skeletal defects in zebrafishThe FEBS JournalDecember 6, 2024Merve Basol, Esra Ersoz‐Gulseven, Helin Ozaktas, Sibel Kalyoncu, Canan Asli Utine, Gulcin Cakan‐AkdoganATCGTGCTCGAGATGGCAAA 3′, reverse 5′ AATGCACAAATGCCCCAGAA 3′ primers and cloned into pGEM‐T vector (#A3600; Promega, Madison, WI, USA). A full‐length antisense probe was synthesized from this plasmid. A short

(19) Biosynthesis of glucosaminyl phosphatidylglycerol in Pseudomonas aeruginosabioRxivOctober 14, 2024Fabiha Zaheen Khan, Kelli L. Palmer, Ziqiang Guanμg/ml gentamicin. Escherichia coli DH5α (Thermo Fisher Scientific) with the plasmid pGEM-T (Promega PR-A3600) was grown in LB broth containing 50 μg/ml ampicillin. Plasmid Construction The gpgSDF operon was

(20) NPY-mediated synaptic plasticity in the extended amygdala prioritizes feeding during starvationNature CommunicationsJune 27, 2024Stephan Dodt, Noah V. Widdershooven, Marie-Luise Dreisow, Lisa Weiher, Lukas Steuernagel, F. Thomas Wunderlich, Jens C. Brüning, Henning Fenselauand 3 MLU (GGA-TCC) primers. The PCR product was then subcloned into a pGEM-T Easy vector (Promega, #A3600) containing two rox and rox-mut sites, respectively. Positive clones were digested with EcoRI and BamHI

Be the First to Write a Review!