NsiI from New England Biolabs

Product Specs
ItemNsiI
CompanyNew England Biolabs
Price $72.00 Inquire
Catalog NumberR0127S
Concentration10 u/µL
Quantity1000 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

ATGCA/T

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Assessing the Toxoplasma Tachyzoite Cell Cycle Phases Using Fluorescent Ubiquitination-Based Cell Cycle IndicatorBIO-PROTOCOLJanuary 20, 2026Mrinalini Batra, Elena S. Suvorova(New England Biolabs, catalog number: R0547S) 49. NsiI endonuclease (New England Biolabs, catalog number: R0127S) 50. EcoRV endonuclease (New England Biolabs, catalog number: R3195) 51. 4% paraformaldehyde solution

(2) Megabase-scale loss of heterozygosity provoked by CRISPR-Cas9 DNA double-strand breaksMolecular CellNovember 20, 2025Samantha B. Regan, Darpan Medhi, Yuanlin Xu, Travis B. White, Yi-Zhen Jiang, Jung Eun Kim, Shih-Chun Wang, Qichen Deng, Su Jia, Dulguun Baasan, et al.R0744 AflII,New England BioLabs,Cat# R0520 ScaI,New England BioLabs,Cat# R3122 NsiI,New England BioLabs,Cat# R0127 T4 DNA ligase,New England BioLabs,Cat# M0202 Phenol-chloroform,Avantar/VWR Life Science,Cat# 97064-694 Platinum II Taq hot-start DNA polymerase

(3) Combining light-induced aggregation and biotin proximity labeling implicates endolysosomal proteins in early α-synuclein oligomerizationiScienceJuly 18, 2025Maxime Teixeira, Razan Sheta, Dylan Musiol, Vetso Ranjakasoa, Jérémy Loehr, Jean-Philippe Lambert, Abid OueslatiTCT TCA GG-3′) cleavage sites. Cleaved material with NheI-HF (NEB, Cat. R3131S) and NSiI (NEB, Cat. R0127S) was then purified as previously described and ligated inside a pDEST FRT-TO TurboID.105 Resulting pFRT-TO

(4) Fortilin deficiency induces anti-atherosclerotic phenotypes in macrophages and protects hypercholesterolemic mice against atherosclerosisCommunications biologyJuly 11, 2025Wanachottrakul N, Pinkaew D, Mukherjee S, Chunhacha P, Nakashima M, Brockman AA, Pal U, Halim HB, Wei Y, Tanaka L, et al.and Southern blotting (using radioactive DNA probes-1 and -2 after NdeI [R0111S, New England BioLabs] and NsiI [R0127S] digestion, respectively) analyses21. Next, we microinjected two of the mutated ESC lines (B43 and B61)

(5) Genome-wide association study (GWAS) provides insights into the genomic basis of reproduction-related traits in Chouardia litardierei (Asparagaceae)BMC Plant BiolMay 2, 2025Sara Laura Šarančić, Nikolina Pleić, Damjan Mitić, Krešimir Križanović, Boštjan Surina, Ivan Radosavljević[52]. In short, DNA was first digested using restriction enzymes AseI and NsiI (NEB # R0526L and # R0127L, respectively). The resulting fragments were ligated with barcoded i5 and i7 adapters, after which all

(6) Uncovering the genomic basis of phenological traits in Chouardia litardierei (Asparagaceae) through a genome-wide association study (GWAS)Frontiers in Plant ScienceApril 17, 2025Sara Laura Šarančić, Nikolina Pleić, Krešimir Križanović, Boštjan Surina, Damjan Mitić, Ivan Radosavljevićal., 2012). DNA was initially digested with two restriction enzymes, AseI and NsiI (NEB #R0526L and #R0127L, respectively). The resulting fragments were then ligated with barcoded i5 and i7 adapters, allowing

(7) γ-Secretase modulator resistance of an aggressive Alzheimer-causing presenilin mutant can be overcome in the heterozygous patient state by a set of advanced compoundsAlzheimers Res TherFebruary 19, 2025Johannes Trambauer, Rosa Maria Rodriguez Sarmiento, Holly J. Garringer, Katja Salbaum, Liliana D. Pedro, Dennis Crusius, Ruben Vidal, Bernardino Ghetti, Dominik Paquet, Karlheinz Baumann, et al.The colonies were then picked and analysed by RFLP assay using NsiI (New England Biolabs, Cat. No. R0127) as described previously [44]. Successful hetero- and homozygous editing was confirmed by Sanger sequencing

(8) Tissue Inhibitor of Metalloproteinase 3 (TIMP3) mutations increase glycolytic activity and dysregulate glutamine metabolism in RPE cellsMolecular MetabolismOctober 1, 2024Allison Grenell, Charandeep Singh, Monisha Raju, Alyson Wolk, Sonal Dalvi, Geeng-Fu Jang, John S. Crabb, Courtney E. Hershberger, Kannan V. Manian, Karen Hernandez, et al.(5′GGGTGGGAATTACAATCCTCAAATG) followed by restriction digestion using enzyme Nsil (New England Biolabs, Cat no. R0127L). Sanger sequencing was performed to verify the mutation correction followed by karyotyping to confirm

(9) Promoter Methylation Leads to Hepatocyte Nuclear Factor 4A Loss and Pancreatic Cancer AggressivenessGastro Hep AdvancesApril 24, 2024Maria Hatziapostolou, Marina Koutsioumpa, Abed M. Zaitoun, Christos Polytarchou, Mouad Edderkaoui, Swapna Mahurkar-Joshi, Jayakumar Vadakekolathu, Daniel D'Andrea, Anna Rose Lay, Niki Christodoulou, et al.for Lucia-secreted luciferase variant, following digestion with NsiI and HindIII restriction enzymes (R0127S and R0104S, respectively, New England Biolabs) and ligation through T4 DNA ligase (M0202S, New England Biolabs

(10) SAS: Split antibiotic selection for identifying chaperones that improve protein solubilityHeliyonMarch 15, 2024Emily McNutt, Na Ke, Alexandre Thurman, James B. Eaglesham, Mehmet Berkmenpromoter sequence (ordered from IDT) into pBAD34. Restriction enzymes NsiI (New England Biolabs, cat#R0127) and NcoI (New England Biolabs, cat#R0193S) were used to linearize pBAD34. The resulting pAL0 vector

(11) Development of CNS tropic AAV1-like variants with reduced liver-targeting following systemic administration in miceMolecular TherapyMarch 6, 2024Matthieu Drouyer, Jessica Merjane, Deborah Nazareth, Maddison Knight, Suzanne Scott, Sophia H.Y. Liao, Samantha L. Ginn, Erhua Zhu, Ian E. Alexander, Leszek Lisowskifocus-forming visrus (SFFV) backbone with SwaI (NEB, catalog no. R0604S) and NsiI (NEB, catalog no. R0127S). Following separation on 1% (w/v) agarose gel and purification using the Zymoclean Gel DNA Recovery

(12) Engineering heterologous enzyme secretion in Yarrowia lipolyticaMicrobial Cell FactoriesDecember 1, 2022Weigao Wang, Mark A. Blennerverification of PAH1 knockout strain To construct the CRISPR knockout vectors, NsiI (Catalog number: R0127S, NEB) was used to digest parent pCas9-Leu or pCas9-URA plasmids [29]. Corresponding primers were used

(13) STRAIGHT-IN enables high-throughput targeting of large DNA payloads in human pluripotent stem cellsCell Rep MethodsOctober 24, 2022Blanch-Asensio A, Grandela C, Brandão KO, de Korte T, Mei H, Ariyurek Y, Yiangou L, Mol MPH, van Meer BJ, Kloet SL, et al.,New England Biolabs,Cat#R0104S EcoRI,New England Biolabs,Cat#R0101S PvuI,New England Biolabs,Cat#R0150S NsiI,New England Biolabs,Cat#R0127S Esp3I,New England Biolabs,Cat#R0734S HaeIII,New England Biolabs,Cat#R0108S MseI,New England Biolabs,Cat#R0525S BpiI,ThermoFisher,Cat#ER1011 FastDigest Eco31I

(14) Designing, optimization, and validation of whole blood direct T-ARMS PCR for precise and rapid genotyping of complex vertebral malformation in cattleBMC BiotechnologyDecember 1, 2021R. R. Alyethodi, U. Singh, S. Kumar, R. Alex, G. S. Sengar, T. V. Raja, R. Deb, B. PrakashPCR was validated by our earlier published method of PCR-PIRA [4] using the NsiI enzyme (NEB India, R0127S). For further comparison, 100 samples which were earlier tested for CVM by PCRPIRA [22] were added and

(15) Impact of C‐terminal amino acid composition on protein expression in bacteriaMolecular Systems BiologyMay 25, 2020Marc Weber, Raul Burgos, Eva Yus, Jae‐Seong Yang, Maria Lluch‐Senar, Luis SerranoONE‐Glo Luciferase Assay System,Promega,E6110 EcoRV,NEB,R0195S XhoI,NEB,R0146S BamHI,NEB,R0136S EcoNI,NEB,R0521S NotI,NEB,R0189S Eco147I,ThermoScientific,FD0424 NsiI,NEB,R0127S T4 ligase,NEB,M0202S Phusion High‐Fidelity DNA Polymerase,ThermoScientific,F530S Chlorampehnicol,Sigma,C0378 Tetracycline,Sigma,T7660 Gentamycin,Sigma,G1397 HEPES,Sigma,H4034 Sucrose,Sigma,84097 Software,Software,Software Python

(16) Population epigenetic divergence exceeds genetic divergence in the Eastern oyster Crassostrea virginica in the Northern Gulf of MexicoEvolutionary ApplicationsMay 1, 2020Kevin M. Johnson, Morgan W. Kellydigested for all 80 samples in a 96‐well plate using the two frequent cutter enzymes AseI and NsiI (NEB‐R0127L and NEB‐R0526L; Van Gurp et al., 2016). Digested DNA was ligated to custom y‐yoked methylated sequencing

(17) Proteome Instability Is a Therapeutic Vulnerability in Mismatch Repair-Deficient CancerCancer cellMarch 16, 2020McGrail DJ, Garnett J, Yin J, Dai H, Shih DJH, Lam TNA, Li Y, Sun C, Li Y, Schmandt R, et al.Express,Invitrogen,Cat# 12605010 Bgll,New England Biolabs,Cat# R0144S Nsil,New England Biolabs,Cat# R0127S BseR1,New England Biolabs,Cat# R0581S Critical Commercial Assays,Critical Commercial Assays,Critical

(18) Luminal lncRNAs Regulation by ERα-Controlled Enhancers in a Ligand-Independent Manner in Breast Cancer CellsInternational journal of molecular sciencesFebruary 16, 2018Miano V, Ferrero G, Rosti V, Manitta E, Elhasnaoui J, Basile G, De Bortoli M.digestion will be done by adding a total of 450 U of restriction enzyme (BglII and NsiI, NEB R0144L and R0127L respectively) overnight at 37 ◦ C while shaking at 300 rpm. A 4.5 µL aliquot was taken by pipetting

(19) Fortilin binds IRE1α and prevents ER stress from signaling apoptotic cell deathNature communicationsMay 26, 2017Pinkaew D, Chattopadhyay A, King MD, Chunhacha P, Liu Z, Stevenson HL, Chen Y, Sinthujaroen P, McDougal OM, Fujise K.and Southern blotting (using radioactive DNA probes 1 and 2 after NdeI [R0111S, New England BioLabs] and NsiI [R0127S] digestion, respectively) for successful homologous recombination (Supplementary Fig. 4B). Two mutated

(20) Protein and Antibody Engineering by Phage DisplayMethods in EnzymologySeptember 3, 2016J.C. Frei, J.R. LaiRestriction enzymes: BssHII, BsiWI, NheI, NsiI, FseI (NEB, Ipswich, MA, catalog #s: R0199S, R0553S, R0131S, R0127S, R0558S, respectively) Alkaline Phosphatase, Calf Intestinal (NEB, Ipswich, MA, catalog #: M0290S)

Be the First to Write a Review!

NsiI

NsiI from New England Biolabs

Sequence

New England Biolabs

Citations (22)

Reviews

NsiI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map