SuperScript IV UniPrime One-Step RT-PCR System 18090050 from Thermo Fisher Scientific

Product Specs
ItemSuperScript IV UniPrime One-Step RT-PCR System
CompanyThermo Fisher Scientific
Price Inquire
Catalog Number18090050
ApplicationsPCR & Real-Time PCR
MethodGel Electrophoresis
Format1-step RT-PCR Kit
Type1-step RT-PCR
Size10,000 units

(1) Case Report: Diagnostic odyssey in rare diseases: when genetic variants are misinterpretedFront PediatrApril 15, 2026Minerva Montero-Hernández, Nahuel Pérez-Moix, María-Carmen Carrascosa-Romero, María-Pilar López-Garrido, Francisco Sánchez-Sánchezμg of total RNA per sample using the SuperScript IV Reverse Transcriptase (Invitrogen, catalog no. 18090050) with a mixture of oligo(dT) and random hexamer primers, according to the manufacturer's protocol. 2.2.3

(2) Sequestration of growth cone surface proteins by cytoplasmic Lrrtm2 induces de novo amygdala innervation by cerebral cortex associative neuronsbioRxivApril 12, 2026Dustin E. Tillman, Omer Durak, Priya Veeraraghavan, John E. Froberg, Garrett Wheeler, Bogdan Budnik, Jeffrey D. Macklisusing a custom BD SORP Aria II. qPCR was performed via SuperScript IV reverse transcriptase (Thermo #18090050) and SsoAdvanced Universal SYBR Green Supermix (BioRad #1725271), using a QuantStudio3 machine (Thermo).

(3) Natural variation in expression of a plant immune receptor mediates elicitor sensitivityPLoS OneApril 3, 2026Brian Behnken, Wesley George, Antonio F. Chaparro, Ava Kloss-Schmidt, Adam D. Steinbrennersynthesized using 1 μg of RNA using the SuperScript IV Reverse Transcriptase Kit (ThermoFisher, Cat. No. 18090050). qPCR reactions were performed using gene-specific primers with PowerUp SYBR Green PCR Master Mix (Thermo Fisher

(4) Convergent evolution increases boron transport through SNPs and tandem duplications at BOR1 and BOR2 in Arabidopsis thalianaProc Natl Acad Sci U S AMarch 31, 2026Emmanuel Tergemina, Célia Neto, Md Mamunur Rashid, Herculano Dinis, David E. Salt, Angela M. Hancockgenerate complementary DNA, we used the SuperScript IV reverse transcriptase (Invitrogen, catalog no. 18090050) with an oligo(dT)18 following the manufacturer’s protocol. We quantified mRNA levels by dPCR as described

(5) Extracellular Vesicle IL5RA and BCMA in Serum Enable Non-Invasive Risk Stratification of Multiple MyelomaCancers (Basel)March 30, 2026Yuko Shirouchi, Hiroki Shinchi, Yoshimi Haga, Yuko Mishima, Sayuri Minowa, Tomoko Takayama, Shunji Takahashi, Dai Maruyama, Koji UedaNetherlands). cDNA was generated using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA, #18090050). A cDNA panel of 48 normal human tissues was purchased from OriGene (Rockville, MD, USA) (HMRT104).

(6) Chromatin dynamics of the Klf4 locus in mouse pluripotent cellsScientific ReportsMarch 27, 2026Jente van Staalduinen, Hélène Kabbech, Selçuk Yavuz, Ridvan Cetin, Agnese Loda, Wiggert van Cappellen, Adriaan Houtsmuller, Kerstin Wendt, Ihor Smal, Frank GrosveldSuperScript IV Reverse Transcriptase kit according to manufacturer’s instructions (Invitrogen, Catalog no: 18090050). After the reverse transcription, the cDNA was diluted five times with TE buffer pH = 8.0. RT-qPCR The

(7) Redox cycling nitroxide limits cellular iron availability and selectively inhibits iron-sulfur cluster metabolismCell Death DiscoveryMarch 24, 2026Erdem M. Terzi, Kenji M. Fujihara, Marte Molenaars, Douglas E. Biancur, Richard Possematoof total RNA is reverse transcribed to cDNA using reverse transcriptase (Thermo Fisher Scientific, 18090050) with 1 μl of RNase OUT (10777019, Invitrogen). Quantitative PCR (qPCR) was performed on cDNA using

(8) Deficiency of Werner RecQ-type DNA helicase causes premature malnutrition in zebrafishiScienceMarch 20, 2026Kota Ujibe, Makoto Kashima, Miku Kataoka, Rintaro Shimada, Masashige Okamoto, Isao Kobayashi, Seiji Wada, Hiroki Matsuda, Akira Sakamoto, Hiromi Hiratawater,Nacalai Tesque,Cat# 06442-95 SuperScript IV reverse transcriptase,Thermo Fisher Scientific,Cat# 18090050 Tris(hydroxymethyl)aminomethane,Nacalai Tesque,Cat# 35434-05 KCl,Wako,Cat# 163-03545 Tween-20,Wako,Cat#

(9) Molecular taxonomy of pancreatic neuroendocrine tumors reveals BEND2-fusions-driven transcriptional plasticity and therapeutic vulnerabilitiesCell Rep MedMarch 17, 2026Xiaofan Lu, Philippe Baltzinger, Li Xu, Antonin Fattori, Sehrish Khan Bazai, Fatima Alhourani, Marie-Pierrette Chenard, Philippe Bachellier, Pietro Addeo, Véronique Debien, et al.polymerase chain reaction (RT-qPCR) was conducted using SuperScript IV Reverse Transcriptase (Invitrogen, 18090050) with random hexamer primers (Invitrogen, SO142). The RT-qPCR was conducted in a 20-μL reaction system

(10) A lncRNA drives developmentally timed decay of all members of an essential microRNA familyGenes & DevelopmentMarch 6, 2026Acadia L. Grimme, Lu Li, Alyshia Scholl, Bridget F. Donnelly, Neha Channamraju, Karl-Frédéric Vieux, Lecong Zhou, Geraldine Seydoux, Mingyi Xie, Katherine McJunkinrelease ligated RNA molecules. Reverse transcription was performed using SuperScript IV (Invitrogen, 18090050) with RT primers (GCCTTGGCACCCGAGAATTCCA). Amplification of cDNA libraries was carried out with 12 PCR

(11) Cell-free DNA methylome and fragmentome analysis for relapse monitoring of Ewing sarcomaEMBO Molecular MedicineMarch 6, 2026Sophie A Richardson, Aram Safrastyan, Mina Karimpour, Gayatri Gulati, Patrick J B Harker, Alan Redfern, Simon P Pearce, Vsevolod J Makeev, Bernadette Brennan, Alexander T J Lee, et al.,KAPA Biosystems (Roche),KK2502 / 7958897001 Invitrogen SuperScript IV Reverse Transcriptase,Thermo Fisher,18090050 KAPA Library Quantification Kit for Illumina Universal,KAPA Biosystems (Roche),KK4906 / 7960417001 Qubit

(12) Selective Silencing of TDP-43 P. G376D Mutation Reverses Key Amyotrophic Lateral Sclerosis-Related Cellular DeficitsBiomoleculesMarch 5, 2026Roberta Romano, Giorgia Ruotolo, Francesco Perrone, Silvia Tomaselli, Martina Mazzoni, Rossella Spataro, Francesca Luisa Conforti, Jessica Rosati, Cecilia Bucciinstructions. cDNA was synthesized from 1 μg of total RNA using SuperScript IV reverse transcriptase (18090050, Invitrogen, Waltham, MA, USA). PCR reactions were prepared with SYBRTM Green PCR Master Mix (4367659,

(13) NimA promotes cell adhesion at the blood brain barrier of the Drosophila nervous systemEMBO ReportsMarch 3, 2026Rosy Sakr, Sara Monticelli, Smrithi Kizhakkenottiyath Shasthadevan, Claude Delaporte, Gege Zhang, Tarek Tabiat, Angela Giangrande, Pierre B CattenozResearch Center,TR 118 DNase I recombinant RNase free,Roche,04716728001 Super-Script IV,Invitrogen,18090050 SYBR Green I Master,Roche,04707516001 DAPI,Sigma-Aldrich,Cat# D9542 Vectashield,Vector Laboratories,H-1000-10 Effectene Transfection Reagent

(14) Hierarchical membrane-chromatin tethering buffers nuclear envelope assembly against alterations in lipid fluxbioRxivMarch 2, 2026Sarah R. Barger, Sofia Sepúlveda, Han Yang, Marc Goudge, Shoken Lee, Neale D. Ridgway, Shirin Bahmanyarreverse transcription using the SuperScript IV Reverse Transcription kit (Thermo Fisher Scientific 18090050) with 400 ng RNA per reaction. The subsequent cDNA was diluted 1:10 for RT-qPCR. cDNA was analyzed for

(15) Integrating natural and engineered genetic variations to decode regulatory influence on blood traitsCell ReportsFebruary 24, 2026Manuel Tardaguila, Dominique Von Schiller, Michela Colombo, Ilaria Gori, Eve L. Coomber, Thomas Vanderstichele, Paola Benaglio, Chiara Chiereghin, Sebastian Gerety, Dragana Vuckovic, et al.,New England Biolabs,Cat#M0303L on-column DNase I,Quiagen,Cat#79254 Turbo Dnase,Invitrogen,Cat#AM1907 SuperScript IV,ThermoFisher,Cat#18090050 RNasin,Promega,Cat#N261A Alt-R™ S.p. Cas9 Nuclease V3,IDT,Cat#1081059 Trichostatin A (TSA),Selleckem,Cat#S1045 M3814,Selleckem,Cat#S8586 5nM

(16) PFKM governs metabolic shifts throughout skeletal muscle differentiationNature MetabolismFebruary 24, 2026Melissa Campos, Steven T. Nguyen, Xiangduo Kong, Ying Yang, Richard L. Watson, Anastasia Gromova, Catherine R. Livelo, Carolina N. Franco, Julia E. Cabral, Laurence J. Seabrook, et al.(R2050, Zymo Research). cDNA was generated using 100–200 ng RNA per reaction and reverse transcriptase (18090050), dNTP mix (FERR0192), random primers (48190011) and RT reaction buffer (18090050B), all purchased from

(17) The allosteric landscape of the Src kinaseSci AdvFebruary 13, 2026Antoni Beltran, Mohsin M. Naqvi, Andre J. Faure, Ben Lehnerto neutralize EDTA. To perform reverse transcription Superscript IV, Thermo Fisher Scientific kit (18090050) was used. The reaction mix was kept at 45°C for 30 min. To remove EDTA and translation machinery, the

(18) hnRNPM cooperates with BCAS2 to modulate alternative splicing during oocyte developmentNature CommunicationsFebruary 12, 2026Shumin Zhou, Dalin Liu, Shiming Gan, Ziqi Yu, Ruibao Su, Hao Zhou, Jiaqi Zhang, Haoran Xu, Yifan Zhao, Hua Zhang, et al.2.83 μL of reverse transcription mixture, comprising SuperScript IV reverse transcriptase (Invitrogen, 18090050), RNase inhibitor (Takara, Cat. 2313A), SuperScript IV first-strand buffer, 1 M betaine (Sigma-Aldrich,

(19) Integrative profiling of condensation-prone RNAs during early developmentCell GenomicsFebruary 11, 2026Tajda Klobučar, Jona Novljan, Ira A. Iosub, Boštjan Kokot, Iztok Urbančič, D. Marc Jones, Anob M. Chakrabarti, Nicholas M. Luscombe, Jernej Ule, Miha Modicextraction as above. 21 μg of RNA was fragmented using 5× First Strand Synthesis Buffer (SuperScript IV, 18090050, Invitrogen) for 3.5 min at 94°C, immediately placed on ice and mixed with the MyOne Streptavidin C1

(20) Unlocking binding properties of single-domain antibodies targeting the polymeric immunoglobulin receptor to enhance mucosal enrichment of IgG against respiratory syncytial virusFrontiers in ImmunologyFebruary 9, 2026Jia Liu, Jiwon Jung, Siqun Zhou, Shi-Juan Chen, Jiping Huang, Yinyan Tang, Karin Vroom, Soha Motlagh, Daoyang Chen, Huong Trinh, et al.previously (54). In brief, cDNA was generated using SuperScript IV reverse transcriptase (Thermo, Cat. 18090050) in the presence of a template switching oligo (TSO) for 5’RACE. Two PCR rounds with GoTaq polymerase

Be the First to Write a Review!

SuperScript IV UniPrime One-Step RT-PCR System

SuperScript IV UniPrime One-Step RT-PCR System

SuperScript IV UniPrime One-Step RT-PCR System

SuperScript IV UniPrime One-Step RT-PCR System from Thermo Fisher Scientific

Description

Citations (646)

Reviews

SuperScript IV UniPrime One-Step RT-PCR System from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map