Agilent BioTek Take3 & Take3 Trio Microvolume Plates from Agilent Technologies

Product Specs
ItemAgilent BioTek Take3 & Take3 Trio Microvolume Plates
CompanyAgilent Technologies
Price Get Pricing Get Quote for this Product
Catalog NumberTake3
QuantityEA
ApplicationsLow volume nucleic acid and protein quantification
SoftwareGen5™ Data Analysis Software

Add to Compare List

Agilent Technologies

5301 Stevens Creek Blvd

Santa Clara, California 95051

United States

Phone: +1 877-424-4536

Company Profile

Website: www.agilent.com

(1) Prenatal arsenic exposure and gene expression in fetal liver, heart, lung, and placentaToxicologyMay 1, 2026Kristal A. Rychlik, Sylvia S. Sanchez, Chloe Kashiwagi, Jin-Shiung Liao, Aakriti Mathur, Emily J. Illingworth, Andre Kleensang, Alexandra Maertens, Fenna C.M. SilléRNeasy Mini kits (Qiagen Inc., Valencia, CA). Quantity and purity of total RNA was measured using a Take3 Microvolume Plate and the Take3 app (Agilent Technologies, Santa Clara, CA). Total RNA was considered

(2) Mapping the nonribosomal specificity code through promiscuity-guided A-domain engineeringChemical ScienceApril 29, 2026Aleksa Stanišić, Carl-Magnus Svensson, Maximilian Müll, Freddy A. Bernal, Hannah Zeihe, Ulrich Ettelt, Hajo Kriesand stored at −20 °C. To determine the protein concentration, absorbance at 280 nm was measured in Take3 plates on an Epoch2 microplate reader (Biotek) and converted into concentrations using calculated extinction

(3) Associations among diet, gut microbiota, and hypertension: a cross-sectional study in Thai subjectsPeerJApril 21, 2026Phatthanaphong Therdtatha, Thanapoj Buakhao, Niwed Kullawong, Vasana Jinatham, Thanakrit Vichasilp, Jiro Nakayama, Siam Popluechaiagarose gel electrophoresis. Spectrophotometry was applied to determine the DNA concentration (ng/µL) using the Take3 Microvolume Plate (Agilent Biotek, Winooski, VT, USA). The total DNA per gram of fecal wet weight was

(4) rRNA expansion segments mediate ribosome dimerization as a conserved stress responseNucleic Acids ResApril 20, 2026Wenhong Jiang, Chen Chen, Xing Wang, Wei Huang, Dawid Krokowski, Ziyao Chen, Jiahao Xie, Zhaoming Su, Maria Hatzoglou, Derek J Taylor, et al.collected, and RNA concentration was determined by absorbance measurements at 260 nm using a BioTek Take3 reader with a Microvolume Plate (Agilent). Polysomes were separated using 10%–50% sucrose gradients

(5) A report of novel inactivating missense mutations of BRCA1 detected in patients with acute myeloid leukemiaJ Med Case RepApril 16, 2026Samina Ejaz, Anam Raashid, Yasir Hameed, Iqra Abdullah, Nagina Imtiaz, Muhammad Iqbal, Maryum Khurshid, Waqas Nazir Malikan already-reported method [27, 28]. The isolated DNA was quantified by the Nano-drop method (Biotek/Take3) and visualized by 1% agarose gel electrophoresis. The extracted DNA was stored at −80 °C. For mutational

(6) Impact of Orchiectomy on Oxidative Stress-Induced Neurodegeneration in the Male Rat Retina: A Proteomic AnalysisAntioxidants (Basel)April 12, 2026Khadiza Zaman, Ammar Kapic, Vien Nguyen, Katalin Prokai-Tatraidescribed [54,55]. Protein content was measured using a BioTek Synergy H1 microplate reader with a Take3 microplate (Agilent, Palo Alto, CA, USA). Samples were normalized to 100 µg of protein each, reduced

(7) Abnormal intestinal microbial colonization in prenatally stressed offspring is related to lung and intestinal cytokine expressionFront MicrobiolApril 9, 2026Audrey F. Duff, Michael T. BaileyCarlsbad, CA). After extraction, RNA quantity (ng/μL) and quality (A260/A280) were verified using the Take3 application “Nucleic Acid Quantification” within the Gen5 software on the Synergy HTX Multi-mode Microplate

(8) Digital Immunoassays for Sensitive Quantification of Blood Biomarkers Using Solid-State NanoporesACS NanoApril 7, 2026Liqun He, Breeana Elliott, Philipp Mensing, Kyle Briggs, Michel Godin, Jonathan Flax, James McGrath, Vincent Tabard-CossaMWCO D-tube Dialyzer (Millipore Sigma, 71508 M). Probe concentrations were then quantified using a Take3 microvolume plate on an EPOC 2 spectrophotometer (BioTek, BTEPOCH2). For nanopore testing, the NanoLock

(9) Acetate and combinations of short-chain fatty acids increase oxidative phenotype and contribute to muscle fiber type shift in myotubesFrontiers in PhysiologyMarch 25, 2026Britt M.J. Otten, Mireille M. J. P. E. Sthijns, Harry R. Gosker, Marco C. J. M. Kelders, Freddy J. Troostundifferentiated unexposed myoblasts were used. RNA quantity was assessed by a Synergy HTX Multimode Reader and Take3 Microvolume Plate and analyzed by Gen5 software (BioTek, Vermont, United States). The iScript cDNA synthesis kit

(10) In Silico-Identified miR-16-5p and miR-32-5p as a Shared Molecular Signature of Primary Gliomas and Parkinson’s Disease: Plasma Levels Are Increased Only in Glioma PatientsBrain SciencesMarch 24, 2026Janusz Szyndler, Zofia Wicik, Anna Wierucka, Piotr Maciejak, Michał Sobstyl, Angelika Stapińska-Syniec, Piotr Glinka, Karol Piwowarski, Natalia Chmielewskaeach plasma sample prior to extraction. The quality and quantity of total RNA were assessed using the Take3 plate on a Synergy H1M1 BioTek reader (BioTek Instruments, Winooski, VT, USA). Tissue samples were homogenized

(11) Myricetin Inhibits Osteosarcoma Cell Viability and Modulates EMT-Related Genes Associated with the SNAI1/MMP-9 AxisPharmaceuticals (Basel)March 18, 2026Isabela Santos, Hélio M. T. Albuquerque, Marta Teixeira Pinto, Nuno Mendes, José Miguel P. Ferreira de Oliveira, Eduarda Fernandes3 (BioTek Instruments, Winooski, VT, USA). Then, total RNA was quantified using the Agilent BioTek Take3 Multi-Volume Plate (Agilent, Santa Clara, CA, USA). From 5 μg of total RNA, first-strand cDNA was synthesized

(12) Integrated Size-Selective Cell Purification and Electroporation for Genetic Manipulation of Primary CellsMicromachines (Basel)March 15, 2026Hyun Woo Sung, Soojung Claire Hurmanufacturer’s protocol. Plasmid concentration and purity were assessed by Nanodrop mode on a spectrophotometer (Take3 Micro-Volume Plate, BioTek Cytation 5, Winooski, VT, USA). For quantitative comparison, microscale electroporation

(13) Dual-function oral nanotherapeutic mitigates sepsis-like multi-organ failure by targeting inflammatory and fibrotic pathwaysBioact MaterMarch 4, 2026James Asenso, Neha Choudhury, Raghu Ganugula, Tyler Posey, Meenakshi Arora, M.N.V. Ravi KumarQiagen) followed by RNA isolation using RNeasy plus universal mini kit (catalog number: 73404, Qiagen). Take3 (BioTek) was used to quantify RNA at 280/260 nm and measurements were obtained with BioTek's citation

(14) Time-restricted feeding rescues sociability deficits and reduces neuroinflammation in aged miceNeurobiology of AgingMarch 1, 2026Louise M. Ince, Brandy N. Routh, Jeffrey S. Darling, Krishi Manem, Akshay Prabhakar, Sophia Martinez, Emily Chan, Ruizhuo Chen, Andrew D. Gaudet, Laura K. Fonkenextraction. RNA was quantified and purity was assessed using a BioTek Synergy HTX Plate Reader with Take3 Microplates and Gen5 Software (Agilent). Samples with 260/280 > 1.8 were used for 3’mRNA Tag Sequencing

(15) Circulating hormonal and gene expression profile in heat-stressed broilers divergently selected for high or low water efficiencyPoultry ScienceMarch 1, 2026Nusrat Jahan, Lulu Liu, Sara Orlowski, Elizabeth S Greene, Sami Dridimanufacturer’s protocol. RNA yield and purity were assessed by microvolume spectrophotometry using a Take3 plate on a Synergy HTX multimode reader (BioTek, Winooski, VT, USA). DNase-treated RNA was then reverse

(16) Impact of plant-based antibiotic alternative supplemented feed on the gut microbiota of Bábolna Tetra-SL chickens experimentally infected with Salmonella enterica and Escherichia coliBMC Veterinary ResearchFebruary 28, 2026Ádám Kerek, Ábel Szabó, Krisztina Bárdos, Zsófia Bata, Viviána Molnár-Nagy, Ákos Jerzsele, László Ózsváriextracted using the IndiSpin Pathogen Kit (Indical Bioscience, Germany). DNA yield was quantified using a Take3 plate on a BioTek Synergy H1 Multimode Reader (Agilent, USA), and DNA extracts were stored at − 20 °C

(17) Phylogenetic insights derived from six Xanthomonas draft genome sequences associated with bacterial spot disease of tomato and pepper in TurkeyAccess MicrobiologyFebruary 27, 2026Amandeep Kaur, Jeffrey B. Jones, Erica M. Goss, Yesim Aysan, Marcus M. Dillon(Invitrogen), and DNA concentration and quality were verified using the BioTek Synergy LX with the Take3 plate (Agilent Technologies). Whole-genome sequencing and assembly All genome sequencing was performed

(18) Distinct Osteogenic Profiles of Tetracyclines from Different Generations in an Ex Vivo Embryonic Chick Femur ModelInternational Journal of Molecular SciencesFebruary 23, 2026Victor Martin, Ana Francisca Bettencourt, Catarina Santos, Maria Helena Fernandes, Pedro Sousa Gomesextraction following the manufacturer’s protocol. RNA quality and concentration were assessed using a Gen5 Take3 module and a microplate reader (Synergy HT, both from Biotek) by absorbance reading (260/280 nm). RNA

(19) Functional effects of EpCAM N-glycosylation in MDA-MB-468 breast cancer cellsScientific ReportsFebruary 20, 2026Nicole M. Jenkinson, Harsh Oza, Kevin J. Yarema, Kristine Glundewas measured using a Biotek Epoch microplate spectrophotometer (Agilent, Lexington, MA, USA) and a Take3 microvolume plate (Agilent). Each of the nine coding DNA sequences (CDS) were amplified separately using

(20) Recessive PPTC7 deficiency triggers excessive mitophagy to cause a severe inborn error of metabolism with hypomyelinating leukodystrophyResearch SquareFebruary 19, 2026Keri-Lyn Kozul, Ali AlAsmari, Essa Alharby, Reem Zakzouk, Youmian Yan, Aziza Mushiba, Anwar Alhamad, Emily Harrelson, Maya Ayach, Kevin Cho, et al.DNeasy Blood & Tissue Kit (Qiagen) according to manufacturer’s instructions. gDNA was quantified using a Take3 Plate Reader (Agilent). Primers targeting Beta-actin (forward: GGCTGTATTCCCCTCCATCG; reverse: CCAGTTGGTAACGCCATGT)

Be the First to Write a Review!