293T from ATCC

Product Specs
Item293T
CompanyATCC
Price $431.00Supplier Page View Company Product Page
Catalog NumberCRL-3216
TypeCell Biology
SpeciesHomo sapiens
Tissuekidney:Embryo
Cell Line293T
Tissue (standardized)Kidney
Agefetus

Add to Compare List

ATCC

10801 University Boulevard

Manassas, Virginia 20110-2209

United States

Phone: (703) 365-2700
Fax: (703) 365-2701

Company Profile

Website: http://www.atcc.org

(1) miR-17-5p inhibits classical swine fever virus replication by targeting the PKD2 -regulated AMPK/mTOR autophagy pathwayVirulenceDecember 31, 2026Xinxian Wang, Shurui Yang, Lichun Xie, Shanshan Qi, Libo Gao, Yongmei Li, Qian Li, Junlong Bi, Jianping Liu, Yongneng Li, et al.and the cell number per well upon cell seeding. The human embryonic kidney cell line HEK-293T (ATCC CRL-3216) was cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine

(2) Streptococcus suis Stk1 sensitizes epithelial cells to ferroptosis and exacerbates disruption of the respiratory epithelial barrierEmerging Microbes & InfectionsDecember 31, 2026Lang Tian, Ruicheng Yang, Ting Qi, Wenquan Ouyang, Hongshuo Liu, Dong Huo, Hang Li, Chuyue Zhou, Manman Xu, Haojie Li, et al.(OD600). Porcine tracheal epithelial cells (NPTr) and human embryonic kidney cells (HEK293 T, ATCC CRL-3216) were maintained in Dulbecco’s Modified Eagle Medium (DMEM/High Glucose, Hyclone) supplemented with

(3) Divergent Rickettsia species exhibit distinct mechanisms of actin-based motilityJournal of Cell BiologyJuly 6, 2026Meghan C. Bacher, Julie E. Choe, Jiawen Jiang, Joanna M. Idrovo, Joshua T. Del Mundo, Michal Hammel, Matthew D. WelchMammalian cell culture and cell line generation Vero (ATCC Cat# CCL-81, RRID:CVCL_0059), HEK293T (ATCC Cat# CRL-3216, RRID:CVCL_0063), A549 (ATCC Cat# CRM-CCL-185, RRID:CVCL_0023), and HMEC-1 (ATCC Cat# CRL-3243, RRID:CVCL_0307)

(4) Comparative analysis reveals molecular adaptation of mammalian HCA2 to microbial metabolitesiScienceJune 19, 2026Franziska Bischof, Petra Krumbholz, Gunnar Kleinau, Patrick Scheerer, Claudia Stäubertovary cell line CHO-K1 (ATCC CCL-6, female) and the human embryonic kidney cell line HEK293-T (ATCC CRL-3216, female) were acquired from the American Type Culture Collection. CHO-K1 cells were grown in Dulbecco’s

(5) SARS-CoV-2 Omicron infection reveals imprinted antibody responses in the absence of vaccinationiScienceJune 19, 2026Adam Abdullahi, Rebecca B. Morse, Mark Tsz Kin Cheng, Fehintola Ige, James Onyemata, Martin Edun, Anezka Kramna, Benjamin Sievers, Sam Turner, Haruna Wisso, et al.Experimental models: Cell lines,Experimental models: Cell lines,Experimental models: Cell lines ,, HEK293T,ATCC,Cat#CRL-3216 HeLa-ACE2,James Voss, Expi293F,ThermoFisher Scientific,Cat#A14527 ,, Software and algorithms,Software

(6) Cgas/sting sensing in dendritic cells discriminates between daptomycin sensitive and resistant staphylococcus aureus clinical isolatesiScienceJune 19, 2026Timothy Patton, Nazneen Jahan, Jhih-Hang Jiang, Xenia Kostoulias, Ee Shan Pang, Rachel J. Lundie, Katherine Balka, Rajan Venkatraman, Viola Oorschot, Joan Clark, et al.paper,N/A Mutu DC Line 2114 STING −/−,This paper,N/A Human embryonic kidney (HEK) 293T cells,ATCC,CRL-3216 ,, Experimental models: Organisms/strains,Experimental models: Organisms/strains,Experimental models:

(7) Uncovering metabolic reprogramming in ovarian and cervical cancers with multi-omicsiScienceJune 19, 2026Yunxiao Ge, Yanlin Luo, Bingbing Hao, Yubing Zhou, Rui Wu, Hangrui Liu, Lin Tang, Yuanying Li, Yushu Li, Shuting Gong, et al.CRM-CRL-1550 SiHa,ATCC,Cat# HTB-35 PA1,ATCC,Cat# CRL-1572 SKOV3,ATCC,Cat# HTB-77 HEK293T,ATCC,Cat# CRL-3216 ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, GATM-F1,This paper,CCGGCCGAGCGTACAGGTCAATTATCTCGAGATAATTGACCTGTACGCTCGGTTTTTG GATM-R1,This

(8) DNA-based delivery of incretin receptor agonists using MYO Technology leads to durable weight loss in a diet-induced obesity modelMol Ther Nucleic AcidsJune 16, 2026Linda Sasset, Andrew D. Cameron, Carleigh Sussman, Luisa Rubinelli, Debnath Maji, Robert Miller, Andy Thompson, Delcora Campbell, Melanie R. Walker, Marek M. Drozdz, et al.blood glucose measured at the indicated times. GLP-1R in vitro reporter assays HEK293T (ATCC, cat# CRL-3216) were seeded at 1.8 × 106 cells in a 10 cm plate in DMEM (Corning Life Sciences, cat# 10-017-CV) completed

(9) Influenza B mosaic HA mRNA-LNP vaccines are cross-reactive and protective in miceMolecular Therapy Nucleic AcidsJune 16, 2026Irene González-Domínguez, Marta Boza, Adam Abdeljawad, William Shea, Eduard Puente-Massaguer, Mitali Mishra, Nicholas Lemus, Tsoi Ying Lai, Hiromi Muramatsu, Kieu Lam, et al.Sequences for the mHA antigens were reported previously.25 Cells, viruses, and vaccines HEK 293 T (CRL-3216, ATCC) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% v/v fetal bovine serum (FBS

(10) Directed evolution of novel AAV capsids for enhanced delivery to mouse and human Schwann cellsMol Ther Nucleic AcidsJune 16, 2026Ana D. Carneiro, Alan M. Nisanov, Hyuncheol Lee, David V. SchafferSchwann cell-associated therapies. Materials and methods Cell culture conditions HEK293T cells (ATCC, CRL-3216) were grown in DMEM (Dow Corning) supplemented with 10% fetal bovine serum (Invitrogen) and 1% Antibiotic-Antimycotic

(11) Engineering novel AAV capsids by broadly attenuated and subsequent muscle-specific tropism in mice and NHPsMolecular Therapy AdvancesJune 11, 2026Yue Pan, Yujian Zhong, Huan Chen, Youwei Zhang, Zhiyong Dai, Junlin Chen, Keqin Tan, Xiaoqu Chen, Danlan Qiu, Longxiang Sheng, et al.resource identifier [RRID]: CVCL_0063; source of the purchase: American type culture collection [ATCC], CRL-3216), human myoblast cell line C2C12 (RRID:CVCL_0188; source of the purchase: ATCC, CRL-1772), human cervical

(12) IL-12-engineered human PSMA-CAR T cells for the treatment of advanced prostate cancerMolecular Therapy AdvancesJune 11, 2026Lupita S. Lopez, Ziyou Cui, Yukiko Yamaguchi, John P. Murad, Zhiyuan Yang, Ke Zou, Jason Yang, Wen-Chung Chang, Stephen J. Forman, Vivien W. Chan, et al.human fibrosarcoma cell line HT1080 (ATCC CCL-12) and the human embryonic kidney cell line 293T (ATCC CRL-3216) were cultured in DMEM (Life Technologies) containing 10% FBS, 1× AA, 25 mM HEPES (Irvine Scientific),

(13) LINGO4 coordinates ILC3-intrinsic IL-22 production and microbiota-mediated ILC3 homeostasisJournal of Experimental MedicineJune 1, 2026José L. Fachi, Tihana Trsan, Cristiane Sécca, Sarah de Oliveira, Vinícius R. Rodovalho, Patrick Fernandes Rodrigues, Wandy L. Beatty, Raki Sudan, Shitong Wu, Bishan Bhattarai, et al.confirmed by sequencing. Lentiviral packaging was performed in the 293T packaging cell line (ATCC, CRL-3216) with Lipofectamine 2000 (Thermo Fisher Scientific) per manufacturer’s protocol. Cells were co-transfected

(14) Quantitative Competition Binding of Fluorinated Ligands by Real‐Time 19 F In‐Cell NMR to Assess Isoform Selectivity in Human CellsMagnetic Resonance in ChemistryJune 1, 2026Azzurra Costantino, Letizia Barbieri, Simone Giovannuzzi, Alessio Nocentini, Claudiu T. Supuran, Enrico Luchinattime of approximately 7 min per sample. 2.2 Human Cell Culture and Transfection HEK293T cells (ATCC CRL‐3216) were cultured in uncoated 75‐cm2 flasks using high‐glucose DMEM, supplemented with 10% FBS, L‐glutamine

(15) Multi-omic analysis reveals nitric oxide dependent remodeling in classically activated macrophages and identifies negative regulation mediated by AKR1A1Redox BiologyJune 1, 2026Nicholas L. Arp, Uzziah S. Urquiza, Marcel Morgenstern, Jonathan H. Schrope, James A. Votava, Steven V. John, Jack J. Stevens, Felicia Deng, Anna Huttenlocher, Joshua J. Coon, et al.protein purification protocol was adapted from a previously described method [8].To generate HEK293T cells (ATCC, CRL-3216) stably expressing FLAG-tagged Akr1a1 or FLAG-tagged Akr1a1(K127A) mutant, lentiviral particles were

(16) Damage to newly synthesized proteins is a major cause of Cd(II) toxicity counteracted by proteasomes and integrated stress response in human cellsChemico-Biological InteractionsJune 1, 2026Giorgiana Madalina Ursu, Anatoly ZhitkovichCell culture Human lung epithelial cells (H460, cat. # HTB-177), immortalized human kidney cells (293T, cat. # CRL-3216) and primary renal proximal tubule epithelial cells (RPTEC, cat. # PCS400010) were obtained from ATCC

(17) PRMT5–mediated symmetric dimethylation of SHBs at Arg169 stabilizes SHBs and promotes angiogenesis and tumor growthTumour Virus ResearchJune 1, 2026Shuxiang Wu, Xiaozhen Chen, Yilin Huang, Fangrong Zhang, Xinjian Lin, Xu Linand Huh7 (JCRB, JCRB0403), endothelial cell line EA.hy926 (ATCC, CRL–2922™), and HEK293T cells (ATCC, CRL–3216) were obtained from the American Type Culture Collection (ATCC) and the Japanese Collection of Research

(18) Protocol for enhancing Cas9 efficiency and fidelity through structure-guided phosphate-locking loop engineeringSTAR ProtocolsJune 1, 2026Meiying Yang, Guanqiao Chen, Ji Xiao, Xin Zhang, Zheng Hu, Bo ZhouCell lines,Experimental models: Cell lines,Experimental models: Cell lines ,, HEK293T cells,ATCC,CRL-3216 ,, "Chemicals, peptides, and recombinant proteins","Chemicals, peptides, and recombinant proteins","Chemicals,

(19) Generative modeling for RNA splicing prediction and designElifeMay 29, 2026Di Wu, Natalie Maus, Anupama Jha, Kevin Yang, Benjamin D Wales-McGrath, San Jewell, Anna Tangiyan, Peter Choi, Jake R Gardner, Yoseph Barashregulatory or negative control sequences were targeted with dCas13d. HEK-293T cells were obtained from ATCC (CRL-3216) and cultured in DMEM (Gibco, 10569010) supplemented with 10% (v/v) FBS (Thermo Fisher Scientific, A3160502)

(20) Ubiquitin ligase ITCH regulates life cycle of SARS-CoV-2 virusElifeMay 29, 2026Qiwang Xiang, Camille Wouters, Peixi Chang, Yu-Ning Lu, Mingming Liu, Haocheng Wang, Haley Heine, Sunning Qian, Junqin Yang, Andrew Pekosz, et al.HEK293 cells were cultured in DMEM supplemented with 10% FBS and 10 μg/ml gentamicin. HEK293 cells (ATCC, CRL-3216) at approximately 40–60% confluence were transfected with mixtures of plasmid DNA and cationic polymer

Be the First to Write a Review!

HardwareX

Description

ATCC

Citations (9040)

Reviews

293T from ATCC

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map