Q5 High-Fidelity 2X Master Mix M0492S from New England Biolabs

Product Specs
ItemQ5 High-Fidelity 2X Master Mix
CompanyNew England Biolabs
Price $200.00 Inquire
Catalog NumberM0492S
Size100 reactions
ApplicationsDNA Analysis
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Cockayne syndrome mutation in XPG activate the integrated stress responseHuman GeneticsDecember 1, 2026Danhui Zhang, Max Hartmann, Zhouli Cao, Gaojie Zhu, Gregoire Najjar, Cagatay Günes, Steffen Emmert, Karin Scharffetter-Kochanek, Sebastian Ibenextraction and cDNA synthesis, DNA products were amplified by using Q5 high-fidelity 2 × master mix (M0492S, NEB). Briefly, DNA products were mixed with Q5 high-fidelity 2 × master mix (M0492S, NEB), 10 μM forward

(2) Identification of the Annexin A2-interacting domain of pneumococcal PsaAmSphereMay 26, 2026Prattay Dey, Yoonsung Hu, Faith Henson, Chaeyoung Kim, Nogi Park, Keun Seok Seo, Justin A. Thorntongene-specific primers in Table S1 using Q5 high-fidelity DNA polymerase (New England Biolabs, Cat# M0492S) following the manufacturer’s protocol. The genes were cloned using the Champion pET100 Directional

(3) Genetically encoded manipulation of ATP/ADP ratio in human cells uncovers proteomic and physiological signatures of energy stressCell Chemical BiologyMay 21, 2026Alex E. Ekvik, Megan M. Kober, Denis V. Titov(New England Biolabs #R3101L) enzymes, and the insert sequences were amplified using a Q5 (New England Biolabs #M0492S) polymerase chain reaction, with the insert sequences and amplification primers shown in Document S2A. Plasmid

(4) Cellular-state control using ribozyme-scaffolded miRNA-sensing and CRISPR-mediated actuationCell Reports MethodsMay 18, 2026Taek Kang, Leonidas Blerismanufacturer’s protocol. Molecular cloning Restriction enzymes, Q5 High-Fidelity 2X Master Mix (NEB, catalog #M0492) and T4 DNA Ligase (NEB, catalog #M0202S) were purchased from New England Biolabs. All primers were

(5) ISGylation is disrupted by UBA7 gene variants identified in individuals with neurodevelopmental disorder phenotypesiScienceMay 15, 2026Venkateshwarlu Bandi, Myrrhe Venema, Iona Wallace, Merel O. Mol, Anita Nikoncuk, Rachel Schot, Marjon van Slegtenhorst, Emilia K. Bijlsma, Amjad Khan, Susan M. White, et al.RR820L In-Fusion Master Mix,Takara Bio,Cat# 638947 Q5 High-Fidelity 2X Master Mix,New England Biolabs,Cat# M0492L Pierce BCA Protein assay kit,Thermo Fisher Scientific,Cat# 23225 ,, Deposited data,Deposited data,Deposited

(6) Rhythmic protein condensation in the circadian regulation of glycogen metabolismiScienceMay 15, 2026Lily A. Burton, Gopal K. Pattanayak, Michael J. Rustproteins","Chemicals, peptides, and recombinant proteins" ,, Q5 High-Fidelity 2X Master Mix,New England Biolabs,Cat# M0492S EcoRI-HF,New England Biolabs,Cat# R3101S Gibson Assembly Master Mix,New England Biolabs,Cat# E2611S "cOmplete,

(7) A High-Throughput Platform for Rapid Adaptation of DNA Aptamers to SARS-CoV-2 EvolutionbioRxivMay 4, 2026Yujie He, Zhenglin Yang, Yu-An Kuo, Yuting Wu, Diego Fonseca-Albert, Kyle K. Le, Jeffrey Guo, Yanxing Wang, Anh-Thu Nguyen, Yuan-I Chen, et al.IDT. The overlap extension PCR process was performed using Q5 High-Fidelity 2× Master Mix from NEB (#M0492) following protocol provided by the manufacturer using a thermal cycler (Applied Biosystems). After

(8) Increased Telomere Mobility in Progeria is Restored by Isoprenylcysteine Carboxyl Methyltransferase InhibitionbioRxivMay 4, 2026Gabriella Gagliano, Alex Raterink, Xijie Yang, Martin Bergö, Anna-Karin GustavssonmStayGold and TRF2 containing compatible overhangs for Gibson assembly were generated by PCR (NEB, M0492S) from plasmids pcDNA3/F-tractin=mStayGold (Addgene #212019, a gift from Atsushi Miyawaki) and pCIBN-tagBFP-hTRF2

(9) Ribosome Molecular Aging Shapes Translation DynamicsbioRxivApril 25, 2026Jordy F. Botello, Lifei Jiang, Peter J. Metzger, Troy J. Comi, Aya A. Abu-Alfa, Qiwei Yu, Margaret S. Ebert, Minkyu Lee, Lennard W. Wiesner, Maya Butani, et al.ligation products were amplified by PCR in a 50 μL reaction using Q5 High-Fidelity 2X Master Mix (NEB, M0492S) with Illumina indexing primers, then cleaned up with SPRI bead purification according to the manufacturer’s

(10) Systematic screening of archaeal MazF homologs reveals Tth-MazF1, a versatile, sequence-specific ribonuclease from Thermococcus thioreducensNucleic Acids ResApril 24, 2026Benjamin F Jepson, Eric J Wolf, Anthony R Dawson, Jingmin Jin, Vladimir Potapov, Nan Dai, Ivan R Corrêa Jr., Erbay Yigitpolymerase chain reaction (PCR) using forward and reverse T7 primers using Q5 PCR master mix (NEB, M0492) and purified (NEB, T1130S). The template DNA was in vitro transcribed using T7 RNA polymerase (NEB,

(11) Phaeochromocytomas and paragangliomas harbour tumour-initiating SOX2+ stem cellsEndocr Relat CancerApril 22, 2026Yasmine Kemkem, Mark Quinn, Bence Kövér, Alice Santambrogio, James Kaufman-Cook, Olivia Sherwin, Laura D Scriba, Dimitria Brempou, Miriam Vazquez Segoviano, Dylan Cameron, et al.Riccio). Sox2 and 2xNLS-eGFP were amplified using Q5® High-Fidelity 2X Master Mix (New England Biolabs, M0492S, USA) as per manufacturer’s instructions using the following primers: Sox2 forward: CGTACCACTTCCTACCCTCGTAAAGGATCCGCCGCCACCATGTATAACATGATGGAGACGGAG. Sox2

(12) Polarized SOS activity orchestrates FGF-directed cell migration in vivoCurrent BiologyApril 20, 2026Theresa V. Gibney, Laila Y. Latifi, Jacob I. Mardick, Neal R. Rasmussen, Maria C. Lyons, Meera V. Sundaram, David J. Reiner, Ariel M. PaniPureLink HQ Mini Plasmid DNA Purification Kit,Invitrogen,K210001 Q5 High-Fidelity 2X Master Mix,New England Biolabs,M0492L Q5 Site-Directed Mutagenesis Kit,New England Biolabs,E0554S Key Resources Table

(13) PALINCODE: Recording cell lineage with ternary palindromic CRISPR bitsbioRxivApril 19, 2026Maryam Fathi, Aidan Cook, Bagheri Bagheri, Tyler Curiel, Aaron McKennaKit (#M2200) were used, all sourced from New England Biolabs (NEB). Q5® High-Fidelity 2X Master Mix (#M0492) from NEB was used for PCR amplification. All PCR products and DNA fragments were purified using the

(14) 2'-O-Methylation maintains ribosome structural and translation integrityMol CellApril 16, 2026Yu Zhao, Jay Rai, Lauren N. Cohen, Yuerong Shu, Chong Xu, Hemant Goswami, Xin Chen, Hong Jin, Virginie Marchand, Yuri Motorin, et al.BIO-TEK,D6942-01 E.Z.N.A.® Gel Extraction Kit,Omega BIO-TEK,D2500-01 Q5® High-Fidelity 2X Master Mix,NEB,M0492S HiScribe® T7 mRNA Kit with CleanCap® Reagent AG,NEB,E2080S Monarch® Spin RNA Cleanup Kit,NEB,T2050L The

(15) Cell-type-targeted mitochondrial transplantation rescues cell degenerationNatureApril 15, 2026Temurkhan Ayupov, Verónica Moreno-Juan, Serena Curtoni, Alex Fratzl, Upnishad Sharma, Susana Posada-Céspedes, Ramona Ratiu, Rei Morikawa, Alexandra Graff Meyer, Margherita Pezzoli, et al.5′-TACATTATACGAAGTTATGGCGCGCCCTAACGTGGCTTCTTCTG-3′, reverse primer: 5′-ATACTTTATACGAAGTTATGCTAGCCACCATGGAGACAGACAC-3′) using Q5 DNA polymerase (NEB, M0492S) and subcloned into the pAAV-ProA5-DIO-DsRed2 backbone (Roska laboratory plasmid collection) through

(16) TEAD1 condensates are transcriptionally inactive storage sites on the pericentromeric heterochromatin in cancer cellsbioRxivApril 12, 2026Yiran Wang, Jindayi Liang, Kimberly S. Lange, Justin Demmerle, Eleanor Liu, Ethan Black, Britney Jiayu He, Christopher J. Ricketts, Shawn R. Yoshida, Shasha Chong, et al.TTCTGCCCACCATTGCATTTCTGTG and the reverse primer GTATGGTAAGTGGCCTGGAACACTCC with Q5 High-Fidelity 2X 901 Master Mix (M0492, NEB). The PCR product was gel extracted using Monarch DNA Gel 902 Extraction Kit (T1020S, NEB) and

(17) Endogenous protein tagging coupled with a CRISPR screening approach identifies UBE3C as a potential MYC oncogene regulatorSci RepApril 11, 2026Marcel Seibert, Nina Kurrle, Sifora Kaleab, Frank Wempe, Ivana von Metzler, Hubert Serve, Frank SchnütgensgRNA-encoding regions was performed using the Q5 High-Fidelity 2X Master Mix (New England Biolabs, Germany, #M0492L). Up to 80 parallel PCRs were performed per sample to ensure sufficient amplification, using staggered

(18) Dispensable players: N-WASP and WASP are not crucial for homology-directed DNA repairEMBO ReportsApril 10, 2026Thu Han Le Phan, Anders Buchard, Cord Brakebuschiodine (PI),Fluka,70335 Puromycin,Gibco,A1113803 Q5 High-Fidelity 2X Master Mix,New England Biolabs,M0492L QuickExtract™ DNA Extraction Solution,Lucigen,QE09050 RAD51 Inhibitor B02,MedChemExpress,HY-101462 RIPA buffer

(19) VaxLab: integrated platform for rapid multistrategy mRNA vaccine designExperimental & Molecular MedicineApril 8, 2026Junsoo Kim, Yoojung Han, Chae Young Kwon, Hyeshik Changsites. PCR amplification was performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0492) with a forward primer (Bionics Korea) contained a T7 promoter sequence, and a reverse primer (Integrated

(20) Paired genomic and proteomic analysis of Acinetobacter towneri from waste sludge reveals an extensive repertoire of enzymes for breakdown of hydrocarbonsMicrobiology SpectrumApril 7, 2026Ronja Marlonsdotter Sandholm, Dave Rojas Calderón, Ørjan Dahl, Ravindra Reddy Chowreddy, Gustav Vaaje-Kolstad, Sabina Leanti La Rosa5′-GGTTACCTTGTTACGACTT-3′), 25 µL Q5 High-Fidelity 2X Master Mix (New England Biolabs, cat. number: M0492S), and 18 µL dH2O. The 16S rRNA gene was amplified using the following program: initial denaturation

Write a Review

(1)

8/6/2019PCR Master Mix for Superior Performance for a Broad Range of Amplicons (NEB) Atul SinghIt works well for all kinds of PCR.

Q5 High-Fidelity 2X Master Mix

Q5 High-Fidelity 2X Master Mix from New England Biolabs

New England Biolabs

Citations (692)

Reviews

Q5 High-Fidelity 2X Master Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map