LongAmpHot StartTaq2X Master Mix M0533S from New England Biolabs

Product Specs
ItemLongAmpHot StartTaq2X Master Mix
CompanyNew England Biolabs
Price $192.00 Inquire
Catalog NumberM0533S
Size100 reactions
ApplicationsDNA Analysis
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) An active Helitron transposon family in wheatNat PlantsJune 5, 2026Haoran Peng, Lijing Tang, Nataliya Hrunyk, Roman Kellenberger, Dario Fossati, Hélène Rimbert, Pierre Sourdille, Shengwei Ma, Alison B. Hickman, Fred Dyda, et al.inverse-PCR-amplified using aliquot-specific primer pairs with LongAmp Taq DNA Polymerase (New England Biolabs, M0533S) and purified. The purified amplicons were mechanically sheared to ∼350 bp using a Bioruptor-pico (Diagenode),

(2) ST8Sia6-dependent glycosylation restrains gut inflammation and pathogenic Th1 and Th17 programsCell ReportsMay 26, 2026Sydney B. Crotts, Jackson T. Barnes, Regina M. Antonetti, Michael J. Shapiro, Naomi M. Gades, William A. Faubion, Kathryn A. Knoop, Virginia Smith Shapiro(Nanopore, SQK-16S114.24) as per manufacturer’s instructions via PCR with LongAmp Hot Start taq (NEB, M0533S). Cleanup was done using Beckman Coulter AMPure XP beads (A63880) before sequencing with a Nanopore

(3) SCOTCH: isoform-level characterization of gene expression through long-read single-cell RNA sequencingNature CommunicationsMay 7, 2026Zhuoran Xu, Hui-Qi Qu, Joe Chan, Shizhuo Mu, Charlly Kao, Hakon Hakonarson, Kai Wangcell cDNA was mixed with 10 μM of both custom primers and LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S). Amplification in a thermal cycler was performed using the following condition: 94 C for 3 min, four

(4) Recombinant LAB vector-based multicomponent vaccine against Campylobacter jejuni potentially promoting a healthier microbial balance in the poultry gutMicrobiomeMay 7, 2026Prakash Biswas, Sakil Ahmed, Samiran Mondal, Samson Oladokun, Ozan Gundogdu, Amirul Islam MallickrRNA (V1-V9 regions) gene by PCR using specific barcodes and LongAmp Hot Start Taq 2X Master Mix (NEB, M0533) for each sample following the manufacturer’s instructions. A total of 36 samples were sequenced (4

(5) Sea Lice ( Lepeophtheirus salmonis ) Harbour Putative Fish Pathogens: Insights From Illumina and Nanopore SequencingJournal of Fish DiseasesApril 8, 2026B. Klimesova, N. M. Ruane, R. Domingo‐Bretón, F. Moroni, F. Naya‐Català, J. Pérez‐Sánchez, K. O'Dwyer, O. Lyashevska, H. Rodger, A. Talbot5′‐CGGTTACCTTGTTACGACTT‐3′) was amplified using LongAmp Hot Start Taq 2 × Master Mix (New England Biolabs, M0533L) in a total volume of 25 μL, with an initial denaturing step at 95°C for 1 min, followed by 25 cycles

(6) Bacteria-soil–plant linkages underlie the mosaic structure of the soil bacterial communities in near-natural stands of Białowieża Primeval ForestScientific ReportsMarch 13, 2026Justyna M. Drewnowska, Wioleta Lewandowska, Piotr Zieliński, Piotr Jadwiszczak, Bogdan Jaroszewicz, Andrzej Keczyński, Olga Hummel, Piotr Majewski, Izabela Święcickathree independent 50 µl reactions per sample, containing 25 µl LongAmp Hot Start 2X Master Mix (NEB, M0533S), 10 ng input DNA (previously adjusted with nuclease-free water to 1 ng/µl), 5 µl nuclease-free water

(7) Growth Performance, Gut Integrity and Intestinal Microbiome Responses of Juvenile Common Carp (Cyprinus carpio L.) to Probiotic and Prebiotic SupplementationAnimals (Basel)January 30, 2026Elshafia Ali Hamid Mohammed, Milán Fehér, Péter Bársony, Christopher Teye-Gaga, Levente Czeglédi, Csongor Freytag, Alex Váradi, Abdelhakam Esmaeil Mohamed Ahmed, Károly Pálprovided in the kit. PCR amplification was carried out using LongAmp™ Hot Start Taq 2X Master Mix (NEB, M0533S) on a VWR Uno 96 thermal cycler. Thermal cycling conditions consisted of an initial denaturation at

(8) Optimizing Tissue Lysis and DNA Extraction Protocols to Enhance Bacterial Diversity Profiling in the Drosophila melanogaster Gut MicrobiomebioRxivJanuary 16, 2026Carlos L. Quiñones-Sanchez, Jan L. Bilbao-Del Valle, Miguel A. Urdaneta-Colon, Tasha M. Santiago-Rodriguez, Imilce A. Rodriguez-FernandezAmplification. Full-length 16s rRNA genes were amplified by PCR using LongAmp® Taq DNA Polymerase (Cat. No. M0533S, New England BioLabs), and the universal bacterial primers 27F (5′-AGA GTT TGA TCC TGG CTC AG-3′) (Integrated DNA Technologies

(9) Mapping single-cell diploid chromatin fiber architectures using DAF-seqNature BiotechnologyDecember 3, 2025Elliott G. Swanson, Yizi Mao, Benjamin J. Mallory, Mitchell R. Vollger, Stephanie C. Bohaczuk, Christopher B. Oliveira, Daniel B. Lyon, Jane Ranchalis, Nancy L. Parmalee, Barak A. Cohen, et al.DNA in 50 ul reactions consisting of 25 μL LongAmp Hot Start Taq 2X Master Mix (New England Biolabs, M0533L), 2 μL each of 10 μM forward and reverse primers (Supplementary Table 8), and 30–100 ng of gDNA. PCR

(10) Feeding the mind: preliminary insights into the effects of Anthocyanin-Rich Extract from black carrots on brain activity and gut microbiota in patients with cognitive impairmentsScientific ReportsNovember 27, 2025Aynur Muduroglu-Kirmizibekmez, Alparslan Onder, Mustafa Yasir Ozdemir, Gamze Gurerk, Sevcan Aydin, Onder Yuksel Eryigit, Mehmet Oktar Guloglu, Ihsan KaraAmplification was carried out using the LongAmp® Hot Start Taq 2X Master Mix (New England Biolabs, M0533S), supplied within the 16S Barcoding Kit, eliminating the need for any additional external proofreading

(11) Widespread Trichuris incognita reveals hidden diversity and reshapes understanding of human whipworm infectionsNature CommunicationsNovember 7, 2025Nurudeen Rahman, Max A. Bär, Julian Dommann, Eveline Hürlimann, Jean T. Coulibaly, Said Ali, Somphou Sayasone, Prudence Beinamaryo, Jennifer Keiser, Pierre H. H. SchneebergerITS2 regions for each sample per plate column. 12.5 μL LongAmp® Hot Start Taq 2× Master Mix (cat no. M0533S, New England BioLabs, USA), 8.5 μL nuclease-free water and 2 µL of source DNA were used in each amplification.

(12) Novel, complex configurations of the MARCHF6 repeat expansion associated with progressive myoclonic epilepsy and familial adult myoclonic epilepsyBrain CommunicationsNovember 3, 2025Mark F Bennett, Mark A Corbett, Thessa Kroes, Laura Canafoglia, Karen L Oliver, Jillian M Cameron, Neblina Sikta, Jacob Munro, Liam G Fearnley, Kristina Ibañez, et al.(LR-PCR) was performed with 50 ng of genomic DNA in LongAmp® HotStart Taq master mix (New England Biolabs #M0533) according to the manufacturer’s conditions except for the following modifications: 5 mM dGTP and dCTP,

(13) TOR signaling regulates GPCR levels on the plasma membrane and suppresses the Saccharomyces cerevisiae mating pathwayJournal of Biological ChemistrySeptember 11, 2025Nicholas R. Leclerc, Toby M. Dunne, Sudati Shrestha, Cory P. Johnson, Joshua B. Kelleyusing OneTaq 2X Master Mix with Standard Buffer (M0482, NEB) or LongAmp Hot Start Taq 2X Master Mix (M0533, NEB). Yeast cell culture for microscopy Cells were grown overnight in 0.22 μm-filtered SCD media

(14) Swine influenza-modified pulmonary microbiotaFrontiers in Cellular and Infection MicrobiologySeptember 8, 2025Javier Arranz-Herrero, Sara Izpura-Luis, Jesus Presa, Paloma Reche, Paloma Encinas, Taeyong Kwon, Sergio Rius-Rocabert, Vicent Tur-Planells, Juan Luis Tejerina, Jordi Ochando, et al.manufacturer’s instructions. The Taq Polymerase used was LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S), as indicated in the protocol. After amplification, DNA was purified using HighPrep beads (Magbio -

(15) From Immediate Impact to Enduring Change: A Transcriptomic Comparison of tDCS’s Temporal Effects and Its Long-Term Equivalence with TMSInternational Journal of Molecular SciencesSeptember 4, 2025Bhanumita Agrawal, Yonatan Feuermann, Julia Panov, Hanoch Kaphzanreverse-transcribed cDNA (5 ml) was amplified using LongAmp Hot Start Taq (NEB, Ipswich, MA, USA; Cat#M0533S) with barcode primers (SQK-RBK114.24) under optimal cycling conditions. Unbound primers were degraded

(16) TOR signaling regulates GPCR levels on the plasma membrane and suppresses the Saccharomyces cerevisiae mating pathwaybioRxivApril 10, 2025Nicholas R. Leclerc, Toby M. Dunne, Sudati Shrestha, Cory P. Johnson, Joshua B. KelleyMaster Mix with Standard Buffer (M0482, NEB, United States) or LongAmp Hot Start Taq 2X Master Mix (M0533, NEB, United States). Yeast Cell Culture for Microscopy Cells were grown overnight in 0.22μm-filtered

(17) True length of diverse capped RNA sequencing (TLDR-seq): 5'-3'-end sequencing of capped RNAs regardless of 3'-end statusNucleic Acids ResApril 4, 2025Jamie Auxillos, Arnaud Stigliani, Christian Skov Vaagensø, William Garland, Adnan Muhammed Niazi, Eivind Valen, Torben Heick Jensen, Albin Sandelin(iii) second-strand cDNA synthesis was carried out using LongAmp HotStart Taq 2× Master Mix (NEB, #M0533L) with 2 μl of 20 μM A2 second-strand primer (Supplementary Table S1) and incubated on a thermocycler

(18) HPV integration profiling using nanopore sequencing and association with cervical precancerous lesionFront MicrobiolMarch 5, 2025Ying Hou, Shoufeng Ni, Xin Liu, Xingyu Liu, Nan Wang, Fuqiang Xu, Jianyong Gao, Yanmei Li, Yuxiang Zhou, Huadong Tang, et al.NEBNext Ultra II End repair/dA-tailing Module (E7546) for end-prep, LongAmp Hot Start Taq 2X Master Mix (NEB, M0533S) for PCR adapters ligation and amplification. The methods were carried out according to a modified protocol.

(19) A Comparative Evaluation of Computational Models for RNA modification detection using Nanopore sequencing with RNA004 ChemistrybioRxivFebruary 8, 2025Yongji Zou, Mian Umair Ahsan, Joe Chan, Wen Meng, Shou-Jiang Gao, Yufei Huang, Kai Wangsecond-strand synthesis, the reverse-transcribed sample was mixed with 25 μL of 2x LongAmp Taq Master Mix (NEB, M0533), 2 μL of 10 μM T7-ext primer, and 3 μL of nuclease-free water. The mixture was incubated under the

(20) Structural variant allelic heterogeneity in MECP2 duplication syndrome provides insight into clinical severity and variability of disease expressionGenome MedicineDecember 18, 2024Davut Pehlivan, Jesse D. Bengtsson, Sameer S. Bajikar, Christopher M. Grochowski, Ming Yin Lun, Mira Gandhi, Angad Jolly, Alexander J. Trostle, Holly K. Harris, Bernhard Suter, et al.using the Q5 Hot Start polymerase (New England BioLabs, NEB# M0494S) or LongAmp Hot Start Taq (NEB# M0533S) annealing temperatures were determined using the NEB Tm calculator (https://tmcalculator.neb.com/#!/main).

Be the First to Write a Review!

LongAmpHot StartTaq2X Master Mix

LongAmpHot StartTaq2X Master Mix from New England Biolabs

New England Biolabs

Citations (36)

Reviews

LongAmpHot StartTaq2X Master Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map