Induro Reverse Transcriptase M0681L from New England Biolabs

Product Specs
ItemInduro Reverse Transcriptase
CompanyNew England Biolabs
Price $396.00 Inquire
Catalog NumberM0681L
Temperature-20 C
ApplicationsDNA Analysis
Size10000 units

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translationNucleic Acids ResApril 30, 2026Dorthy Fang, John M Babich, Ryan Stanton, Isaac W Vock, Kyrillos Abdallah, Mingyi Zhu, Raj Letchuman, Richard Li, Matthew D Simon, Wendy V Gilbert, et al.RNA. Input pooled RNA and purified 80S-bound RNA were then reverse transcribed using Induro RT (NEB, M0681) using oKA210 primer. Following reverse transcription at 60°C for 1 h, samples were processed as described

(2) HIV-1 infection does not confer intrinsic resistance to cell death induced by cytotoxic T lymphocytesbioRxivMarch 27, 2026Niklas Bachmann, Bailey Kim, Colin Kovacs, Steven Deeks, Rebecca Hoh, Francesco R. Simonetti, Janet D. Siliciano, Robert F. Silicianointo cDNA using oligo-dT and random hexamer primers using Induro Reverse Transcriptase (NEB, Cat. # M0681S) including RNaseOUT (ThermoFisher, Cat. # 10777019). The mix of primers and RNA was first denatured

(3) Autologous neutralizing antibodies and polyfunctional T cells contribute to long-term HIV-1 post-intervention controlNature ImmunologyMarch 3, 2026Katie Fisher, Mauro A. Garcia, Giacomo S. Frattari, Chloé Naasz, Junlin Zhuo, Miriam Rosás-Umbert, Lisa L. Dietz, Anna Karina Juhl, Emma Falling Iversen, Rikke Olesen, et al.viremia env sequencing76. cDNA was synthesized using Induro Reverse Transcriptase (New England Biolabs, M0681L). RNA and primer (OFM19) were first denatured at 65 °C for 5 min then snap-cooled at −20 °C. Reverse

(4) Comparative RNA Structure Analysis of Nascent and Mature Transcripts in Saccharomyces cerevisiaeJournal of Visualized ExperimentsFebruary 27, 2026Lokha Ranjani Alagar Boopathy, Leena P. Sen, Leonard Schärfen, Karla M. NeugebauerAldrich,E7023-500ML GlycoBlue,Invitrogen,AM9516 Induro® Reverse Transcriptase,New England Biolabs,M0681S Isoamyl alcohol,Sigma Aldrich,W20571-1KG-K Isopropanol,JT-BAKER,9084-05-01 KAPA HiFi HotStart PCR

(5) Diverse database and machine learning model to narrow the generalization gap in RNA structure predictionScience AdvancesFebruary 27, 2026Albéric A. de Lajarte, Yves J. Martin des des Taillades, Justin Aruda, Pierre Bongrand, Federico Fuchs Wightman, Dragui Salazar, Matthew F. Allan, Colin Kalicki, Casper L’Esperance-Kerckhoff, Alex Kashi, et al.samples were reverse transcribed with Induro Reverse Transcriptase (New England Biolabs, catalog no. M0681L) for 30 min at 55°C using the appropriate reverse primer for each library according to the manufacturer’s

(6) High-throughput analyses of a reconstituted diversity-generating retroelement identify intrinsic and extrinsic determinants of diversificationPLoS GenetFebruary 5, 2026Irem Unlu, Marina K. Smiley, Vladimir Potapov, Yoan Renoux-Martin, Zhi-Yi Sun, Hoong Chuin LimcDNA within cDNA-TR hybrids, 1 μg of the extracted RNA was reverse transcribed using Induro RT (NEB, M0681) with primers that bind to the 3’ end of the cDNA. These primers were oNEB-344 (for pDGR1, Fig 2E–2G)

(7) An Alternative DNA Endonuclease Activity is Associated with the LINE-1 ORF2-encoded ProteinbioRxivJanuary 23, 2026Mitsuhiro Nakamura, Huira C. Kopera, Mark Dowling, Orsolya Barabas, John V. Moranresults. Complementation reverse transcription-PCR (RT-PCR) assay MMLV RT (RNase H-) (Promega M5301) and Induro RT (NEB M0681S) were diluted to 10 U/μL in RT Buffer (50 mM Tris-HCl pH 7.5, 50 mM KCl, 5 mM MgCl2, and 0.05% Tween-20).

(8) Potyviruses recruit host eIF4A3 to block m6A-mediated RNA decay by steric hindrance of viral RNA methylation in plantsNucleic Acids ResearchJanuary 8, 2026Dezhi Peng, Laihua Dong, Pei Wang, Lianyi Zang, Jinhao Xie, Hao Wang, Xiangdong Li, Zaifeng Fan, Tao Zhou, Kaitong DuReverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl

(9) Genome-wide analysis of FSHD cell lines using Nanopore sequencing reveals allele-specific differences at DUX4 target genes and complex repeatsbioRxivDecember 29, 2025Jasmine Shaaban Sakr, Xiangduo Kong, Negar Mojgani, Erisa Taghizadeh, Elnaz Abdollahzadeh, Kyoko Yokomori, Ali Mortazavi2.5uL of 10 mM dNP solution (NEB, cat. #N0447) and 2.5 uL of 5x Induro RT reaction buffer (NEB, cat. #M0681) when making the reverse transcription master mix. Libraries were recovered, and the concentration was

(10) Improved long-transcript representation in Oxford Nanopore direct RNA sequencing with UltraMarathonRTbioRxivDecember 12, 2025George Maio, Li-Tao Guo, Sara Olson, Brenton R. Graveley, Jason G. Underwood(ThermoScientific™, Cat#K1652), SuperScript™ IV (Invitrogen™, Cat#18091300), and Induro®RT (NEB™, Cat#M0681) at their recommended reaction temperatures for 0, 10, 20, and 30 min respectively. Samples were then

(11) A novel plasmid-based co-tethered transcription platform for high yield, high purity mRNA synthesisNucleic Acids ResDecember 11, 2025Purnima Mala, Ruptanu Banerjee, Amin Abek, James Forster Iii, Aniruddha Pinjari, Ashish A Kulkarni, Craig T Martinsystem Reverse transcription of RNA was conducted using Induro Reverse Transcriptase (New England Biolabs, M0681S) with gene-specific primers, adhering to the manufacturer’s protocol. The reaction was incubated at

(12) Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translationbioRxivDecember 8, 2025Dorthy Fang, John M. Babich, Ryan Stanton, Isaac W. Vock, Kyrillos Abdallah, Mingyi Zhu, Richard Li, Matthew D. Simon, Wendy V. Gilbert, Sigrid NachtergaeleRNA. Input pooled RNA and purified 80S-bound RNA were then reverse transcribed using Induro RT (NEB, M0681) using oKA210 primer. Following reverse transcription at 60°C for 1 hour, samples were processed as

(13) CRISPR-free RNA base editing mediated PTC-readthrough restores hearing in mice with Otof nonsense mutationNature CommunicationsDecember 6, 2025Hanxiao Sun, Qi Teng, Wenqing Liu, Rui Guo, Menghua Li, Wei Xiong, Qiang Huang, Qianru Yu, Nan Luo, Yang Li, et al.performed with an adapter-specific primer (ACACGACGCTCTTCCGATCT) and Induro reverse transcriptase (NEB, M0681S) at 42 °C overnight, after which excess primers were digested with Exonuclease I (NEB, M0293S). The

(14) Induro-seq to analyze subcellular enrichment of small RNAsMethods in EnzymologyDecember 3, 2025Monima Anam, Xisheng Liu, Taylor L. Schanel, Christopher D. Willey, Zhangli SuQuick-Load pBR322 DNA-MspI Digest and NEBNext Index (1-48) Primer for Illumina. Induro RT Enzyme (NEB # M0681L): 1 μL per sample. 1 X TBE Buffer (prepared fresh): 500 mL per run. 8% TBE polyacrylamide Novex

(15) A rare genetic variant confers resistance to neurodegeneration across multiple neurological disorders by augmenting selective autophagyNeuronNovember 19, 2025Katherine R. Croce, Christopher Ng, Serihy Pankiv, Eddy Albarran, Peter Langfelder, Ana Ramos Ramos de Jesus, Glenn M. Duncan, Nan Wang, Anna Basile, Caitlin McHugh, et al.16140071 Actinomycin D,ThermoFisher,Cat# 11805017 Induro Reverse transcriptase,New England Biolabs,Cat# M0681S Smartscribe Reverse Transcriptase,Takarabio,Cat# 639536 Fibrillized mouse α-Syn,This paper,"Polinski,

(16) A portable poison exon for small-molecule control of mammalian gene expressionNature MethodsNovember 3, 2025Qian Hou, Maxim Oleynikov, Xiaohan Mei, Linghao Dong, Timo Hagen, Samie R. Jaffreysequencing library preparation Reverse transcription was performed using Induro Reverse Transcriptase (NEB M0681S) according to the manufacturer’s protocol, with the following changes. RNA (500 ng) was mixed with 10

(17) Host adaptation and genome evolution of the broad host range fungal rust pathogen, Austropuccinia psidiiG3: Genes, Genomes, GeneticsOctober 28, 2025Zhenyan Luo, Peri A Tobias, Lavi Singh, Chongmei Dong, Alyssia M Martino, Elle Saber, Maria C Quecine, Nelson S Massola, Lilian Amorim, Peng Zhang, et al.was done with Induro Reverse Transcriptase following the Induro Reverse Transcriptase Protocol (NEB M0681). The remaining library preparation and ONT Direct RNA sequencing kit (SQK-RNA002) were performed using

(18) FTO depletion does not alter m 6 A stoichiometry in AML mRNA: a reassessment using direct RNA nanopore sequencingbioRxivOctober 27, 2025Luke S. Nicholson, Catarina Guimarães-Teixeira, Jianheng Fox Liu, Hui Xian Poh, Samie R. Jaffreyroom temperature. Samples were then reverse transcribed with 1 μl Induro Reverse Transcriptase (NEB, M0681L), 8 μl 5x Induro buffer, 2 μl 10 mM dNTP, and 14 μl nuclease-free water following the incubation protocol:

(19) Resistance to radiation enhances metastasis by altering RNA metabolismSci AdvOctober 17, 2025Ayush Kumar, Kensei Kishimoto, Hira L. Goel, Christi A. Silva, Rui Li, Brendan Pacheco, Lihua J. Zhu, William A. Flavahan, Arthur M. Mercurioμl MgCl2 (NEB, B9021S; 25 mM), 2 μl of 10 mM deoxynucleotide triphosphates, 2 μl of Induro-RT (NEB, M0681; 200 units/μl), and 13.2 μl of ddH2O. The tubes were incubated at 23°C for 10 min; 30°C for 5 min, warmed

(20) SEISMICgraph: a web-based tool for RNA structure data visualizationNucleic Acids ResearchJuly 31, 2025Federico Fuchs Wightman, Grant Yang, Yves J Martin des Taillades, Casper L’Esperance-Kerckhoff, Scott Grote, Matthew F Allan, Daniel Herschlag, Silvi Rouskin, Lauren D Haglersometimes helpful. The purified RNAs were reverse transcribed using the Induro Reverse Transcriptase (NEB, #M0681), as described previously with minor modifications [24]. The reaction was performed as follows: 500–1000

Be the First to Write a Review!

Induro Reverse Transcriptase

Induro Reverse Transcriptase from New England Biolabs

New England Biolabs

Citations (34)

Reviews

Induro Reverse Transcriptase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map