Induro Reverse Transcriptase from New England Biolabs

Product Specs
ItemInduro Reverse Transcriptase
CompanyNew England Biolabs
Price $396.00 Inquire
Catalog NumberM0681L
Temperature-20 C
ApplicationsDNA Analysis
Quantity10000 units

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Long non-coding RNA triplex-dependent regulation of melanoma gene networksNAR Genom BioinformJune 27, 2026Kushani Shah, Eleni Anastasakou, Leinal Sejour, Serafima Guseva, Christopher Rauchet, Leon Wert-Lamas, Riccardo Calandrelli, Robert Distel, Sheng Zhong, Ioannis Vlachos, et al.quantified by nanodrop, and 1 μg of RNA was reverse transcribed with Induro reverse transcriptase (NEB, M0681) with random 6-mer primers following the manufacturer’s protocol and with extension time for 1 h. Induro

(2) Systematic assessment of diverse RNA modifications using nanopore direct RNA sequencingNucleic Acids ResearchMay 4, 2026Xinqi Kang, Kelly Zhang, Alexandre Goyon, William StephensonN0447), and Induro® RT Reaction Buffer (NEB, B0681AVIAL), followed by Induro® Reverse Transcriptase (NEB, M0681), and incubated at 60°C for 30 min, then 70°C for 10 min. The reverse transcription product was purified

(3) Genetic variation reveals a homeotic long noncoding RNA that modulates human hematopoietic stem cellsCellMay 1, 2026Peng Lyu, Gaurav Agarwal, Chun-Jie Guo, Adam Sychla, Wallace Bourgeois, Tianyi Ye, Chen Weng, Mateusz Antoszewski, Samantha Joubran, Alexis Caulier, et al.Microscopy Sciences,11655 Dimethyl sulfate,Sigma-Aldrich,D186309-100ML Induro® Reverse Transcriptase,NEB,M0681L CloneAmp™ HiFi PCR Premix,Takara,639298 N-Lauroylsarcosine sodium salt solution,Sigma-Aldrich,61747-100ML Dextran

(4) Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translationNucleic Acids ResApril 30, 2026Dorthy Fang, John M Babich, Ryan Stanton, Isaac W Vock, Kyrillos Abdallah, Mingyi Zhu, Raj Letchuman, Richard Li, Matthew D Simon, Wendy V Gilbert, et al.RNA. Input pooled RNA and purified 80S-bound RNA were then reverse transcribed using Induro RT (NEB, M0681) using oKA210 primer. Following reverse transcription at 60°C for 1 h, samples were processed as described

(5) Cytoplasmic localization of pseudouridine synthase 7 facilitates a pseudouridine-dependent enhancement of cellular stress toleranceNature CommunicationsApril 17, 2026Minli Ruan, Sean M. Engels, Matthew R. Burroughs, Xiaoyan Li, Rosella Stower, Talia Tzadikario, Connor Powell, Dylan Bloch, Oleksandra Fanari, Stuart Akeson, et al.SuperScript III Reverse Transcriptase (Invitrogen 18080044) for RNA002 and Induro® Reverse Transcriptase (NEB M0681) for RNA004. The IVT-mRNA library was prepared for sequencing using the same procedure as for cell-derived

(6) HIV-1 infection does not confer intrinsic resistance to cell death induced by cytotoxic T lymphocytesbioRxivMarch 27, 2026Niklas Bachmann, Bailey Kim, Colin Kovacs, Steven Deeks, Rebecca Hoh, Francesco R. Simonetti, Janet D. Siliciano, Robert F. Silicianointo cDNA using oligo-dT and random hexamer primers using Induro Reverse Transcriptase (NEB, Cat. # M0681S) including RNaseOUT (ThermoFisher, Cat. # 10777019). The mix of primers and RNA was first denatured

(7) RNA functional modulation by Mitoxantrone via RNA structural ensemble repartitioningNature CommunicationsMarch 23, 2026Chundan Zhang, Ivana Borovská, Teona Iobashvili, Edoardo Morandi, Marta Lionnez, Oluwatosin S. Olayinka, Rinse de Boer, Massimiliano Clamer, Martin D. Witte, Klaus Pors, et al.on ice for 1 min. Reactions were then supplemented with 0.5 μl Induro® Reverse Transcriptase (cat. M0681L, New England Biolabs), 0.25 μl SUPERase•In™ RNase Inhibitor, 2 μl 5X RT Buffer [250 mM Tris-HCl pH 8.3;

(8) Autologous neutralizing antibodies and polyfunctional T cells contribute to long-term HIV-1 post-intervention controlNature ImmunologyMarch 3, 2026Katie Fisher, Mauro A. Garcia, Giacomo S. Frattari, Chloé Naasz, Junlin Zhuo, Miriam Rosás-Umbert, Lisa L. Dietz, Anna Karina Juhl, Emma Falling Iversen, Rikke Olesen, et al.viremia env sequencing76. cDNA was synthesized using Induro Reverse Transcriptase (New England Biolabs, M0681L). RNA and primer (OFM19) were first denatured at 65 °C for 5 min then snap-cooled at −20 °C. Reverse

(9) Comparative RNA Structure Analysis of Nascent and Mature Transcripts in Saccharomyces cerevisiaeJournal of Visualized ExperimentsFebruary 27, 2026Lokha Ranjani Alagar Boopathy, Leena P. Sen, Leonard Schärfen, Karla M. NeugebauerAldrich,E7023-500ML GlycoBlue,Invitrogen,AM9516 Induro® Reverse Transcriptase,New England Biolabs,M0681S Isoamyl alcohol,Sigma Aldrich,W20571-1KG-K Isopropanol,JT-BAKER,9084-05-01 KAPA HiFi HotStart PCR

(10) Diverse database and machine learning model to narrow the generalization gap in RNA structure predictionScience AdvancesFebruary 27, 2026Albéric A. de Lajarte, Yves J. Martin des des Taillades, Justin Aruda, Pierre Bongrand, Federico Fuchs Wightman, Dragui Salazar, Matthew F. Allan, Colin Kalicki, Casper L’Esperance-Kerckhoff, Alex Kashi, et al.samples were reverse transcribed with Induro Reverse Transcriptase (New England Biolabs, catalog no. M0681L) for 30 min at 55°C using the appropriate reverse primer for each library according to the manufacturer’s

(11) High-throughput analyses of a reconstituted diversity-generating retroelement identify intrinsic and extrinsic determinants of diversificationPLoS GenetFebruary 5, 2026Irem Unlu, Marina K. Smiley, Vladimir Potapov, Yoan Renoux-Martin, Zhi-Yi Sun, Hoong Chuin LimcDNA within cDNA-TR hybrids, 1 μg of the extracted RNA was reverse transcribed using Induro RT (NEB, M0681) with primers that bind to the 3’ end of the cDNA. These primers were oNEB-344 (for pDGR1, Fig 2E–2G)

(12) An Alternative DNA Endonuclease Activity is Associated with the LINE-1 ORF2-encoded ProteinbioRxivJanuary 23, 2026Mitsuhiro Nakamura, Huira C. Kopera, Mark Dowling, Orsolya Barabas, John V. Moranresults. Complementation reverse transcription-PCR (RT-PCR) assay MMLV RT (RNase H-) (Promega M5301) and Induro RT (NEB M0681S) were diluted to 10 U/μL in RT Buffer (50 mM Tris-HCl pH 7.5, 50 mM KCl, 5 mM MgCl2, and 0.05% Tween-20).

(13) Multiple Quality Control Checkpoints Safeguard Small Nuclear RNA Biogenesis and Prevent Assembly of Aberrant SpliceosomesbioRxivJanuary 16, 2026Tiantai Ma, Claire Huntington, Zhuoyi Song, Rea M. Lardelli, Eric L. Van Nostrand, Jens Lykke-AndersenLipofectamine™ 2000 Transfection Reagent,ThermoFisher,Cat #11668027 Turbo DNase,ThermoFisher,Cat #AM2239 Proteinase K,NEB,Cat #M0681L SuperScript™ III Reverse Transcriptase,ThermoFisher,Cat #18080044 T4 Polynucleotide Kinase,NEB,Cat

(14) Potyviruses recruit host eIF4A3 to block m6A-mediated RNA decay by steric hindrance of viral RNA methylation in plantsNucleic Acids ResearchJanuary 8, 2026Dezhi Peng, Laihua Dong, Pei Wang, Lianyi Zang, Jinhao Xie, Hao Wang, Xiangdong Li, Zaifeng Fan, Tao Zhou, Kaitong DuReverse-transcription reagents were then added to the 15 μl ligation mixture: 8 μl 5 × First-Strand Buffer (NEB, M0681), 2 μl 10 mM dNTPs (NEB, N0447), 9 μl nuclease-free water, 4 μl 0.1 M dithiothreitol (DTT), and 2 μl

(15) Genome-wide analysis of FSHD cell lines using Nanopore sequencing reveals allele-specific differences at DUX4 target genes and complex repeatsbioRxivDecember 29, 2025Jasmine Shaaban Sakr, Xiangduo Kong, Negar Mojgani, Erisa Taghizadeh, Elnaz Abdollahzadeh, Kyoko Yokomori, Ali Mortazavi2.5uL of 10 mM dNP solution (NEB, cat. #N0447) and 2.5 uL of 5x Induro RT reaction buffer (NEB, cat. #M0681) when making the reverse transcription master mix. Libraries were recovered, and the concentration was

(16) Improved long-transcript representation in Oxford Nanopore direct RNA sequencing with UltraMarathonRTbioRxivDecember 12, 2025George Maio, Li-Tao Guo, Sara Olson, Brenton R. Graveley, Jason G. Underwood(ThermoScientific™, Cat#K1652), SuperScript™ IV (Invitrogen™, Cat#18091300), and Induro®RT (NEB™, Cat#M0681) at their recommended reaction temperatures for 0, 10, 20, and 30 min respectively. Samples were then

(17) A novel plasmid-based co-tethered transcription platform for high yield, high purity mRNA synthesisNucleic Acids ResDecember 11, 2025Purnima Mala, Ruptanu Banerjee, Amin Abek, James Forster Iii, Aniruddha Pinjari, Ashish A Kulkarni, Craig T Martinsystem Reverse transcription of RNA was conducted using Induro Reverse Transcriptase (New England Biolabs, M0681S) with gene-specific primers, adhering to the manufacturer’s protocol. The reaction was incubated at

(18) Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translationbioRxivDecember 8, 2025Dorthy Fang, John M. Babich, Ryan Stanton, Isaac W. Vock, Kyrillos Abdallah, Mingyi Zhu, Richard Li, Matthew D. Simon, Wendy V. Gilbert, Sigrid NachtergaeleRNA. Input pooled RNA and purified 80S-bound RNA were then reverse transcribed using Induro RT (NEB, M0681) using oKA210 primer. Following reverse transcription at 60°C for 1 hour, samples were processed as

(19) CRISPR-free RNA base editing mediated PTC-readthrough restores hearing in mice with Otof nonsense mutationNature CommunicationsDecember 6, 2025Hanxiao Sun, Qi Teng, Wenqing Liu, Rui Guo, Menghua Li, Wei Xiong, Qiang Huang, Qianru Yu, Nan Luo, Yang Li, et al.performed with an adapter-specific primer (ACACGACGCTCTTCCGATCT) and Induro reverse transcriptase (NEB, M0681S) at 42 °C overnight, after which excess primers were digested with Exonuclease I (NEB, M0293S). The

(20) Induro-seq to analyze subcellular enrichment of small RNAsMethods in EnzymologyDecember 3, 2025Monima Anam, Xisheng Liu, Taylor L. Schanel, Christopher D. Willey, Zhangli SuQuick-Load pBR322 DNA-MspI Digest and NEBNext Index (1-48) Primer for Illumina.Induro RT Enzyme (NEB # M0681L): 1 μL per sample.1 X TBE Buffer (prepared fresh): 500 mL per run.8% TBE polyacrylamide Novex gel (Invitrogen

Be the First to Write a Review!