Lambda DNA from New England Biolabs

Product Specs
ItemLambda DNA
CompanyNew England Biolabs
Price $298.00 Inquire
Catalog NumberN3011L
Source/Expression SystemIsolated from bacteriophage lambda (cI857ind 1 Sam 7)
Molecule NameDNA
Quantity1250 µg
ApplicationsDNA Manipulation
DNA TypeLambda DNA
Size Range48.5 Kbp
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Linear and nonlinear optical properties of DNA in suspensionsOptical MaterialsJune 26, 2026Arturo Ramirez, Lipi Patel, Andres Morin, Jesus Poblano, Rebecca Sipen, Chhandak Basu, Anna Bezryadinamedium-sized DNA with 48,502 base pairs [10]. The lambda DNA was bought from New England Biolabs (Cat #N3011S) with a stock concentration of 500 μg/ml. 2.1.3. Strawberry DNA extraction We used genomic DNA from

(2) SmartTrap: automated precision experiments with optical tweezersNature MethodsJune 18, 2026Martin Selin, Antonio Ciarlo, Giuseppe Pesce, Lars Bengtsson, Joan Camunas-Soler, Vinoth Sundar Rajan, Fredrik Westerlund, L. Marcus Wilhelmsson, Isabel Pastor, Felix Ritort, et al.nmol",Roche,11093088910 Deoxynucleotide solution set,NEB,N0446S EagI restriction enzyme,NEB,R3505S "λ-DNA, 250ug",NEB,N3011S Klenow fragment (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts}

(3) A multiplex PCR-based sequencing method for the diagnosis and differentiation of echinococcosis using plasma samples, a proof-of-concept studyCell Reports MethodsJune 15, 2026Yanping Zhao, Yeqin Wang, Ming Zhi, Lin Yang, Wending Pang, Tian Chen, Yiyang Shi, Shu Shen, Hong-Bin Yan, Chunyang Li, et al.multilocularis).20,25,29,32 See Tables S1 and S2. The panel used Lambda DNA as a spike-in control (NEB, N3011S) with 1,000 copies/reaction (5 primer pairs), and human genomic DNA from cell line (GM12878) as an internal

(4) Engineering quantum dot surfaces to preserve protein-DNA interactions for single-molecule visualizationNano ConvergJune 3, 2026Youngseo Kim, Hyerim Kim, Munryul Choi, Hyun Suk Kim, Soyeong An, Orlando D. Schärer, Jongnam Park, Ja Yil Leeassays, Biotin-cos-R and multi-Dig-cos-L oligomers were added to lambda phage DNA (New England Biolabs, N3011) at a 500-fold molar excess. The mixture was incubated at 65 °C for 20 min and slowly cooled to 23 °C.

(5) Improved short nascent strand sequencing (iSNS-seq) enhances DNA replication origin detection and reduces non-origin biasesbioRxivMay 30, 2026Miiko Sokka, John M. Urban, Nicola Neretti, Susan A. Gerbi(for the primer sequences, see Table 1) and Lambda DNA (New England Biolabs, Ipswich, MA, catalog Nr. N3011) as a template (Supplementary Figure S1). We first optimized the PCR cycling conditions and verified

(6) A scalable Tn5-based method for genome-wide DNA methylation profiling in development and diseaseNature CommunicationsMay 22, 2026Hanrong Hu, Nahuel Simonet, Ece Naz Bilgiç, Heather Murray, Regina Reimann, Markus Rechsteiner, Fides ZenkFor elution from the columns, 10 pg of Tn5-digested and purified lambda DNA (New England Biolabs, #N3011S) were added as a spike-in normalizer for later analysis. Overview of the antibodies used in the study: 5mC

(7) High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand BreaksJournal of Molecular BiologyMay 15, 2026Chathuni Jayathilake, Clare E. Mewhinney, Emily R. Gregory-Lott, Rajbinder K. Virk, Riya Nair, Junseo Yang, Eun Cho, Alexander G. Day, Derek J. Taylor, Tae Hun Kimperformed using company-supplied purified DNA as the template. To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward

(8) APE1 coordinates its disordered region and metal cofactors to drive genome surveillanceNucleic Acids ResMay 14, 2026Donghun Lee, Subin Kim, Gyeongpil Jo, Juwon Kim, Jungmin Yoo, Jejoong Yoo, Ja Yil Lee, Gwangrog Leewas finally purified by isopropanol precipitation. For DNA curtain experiments, 10 nM of lambda DNA (N3011S, NEB) or λ-I3 was mixed with 1 μM of lambda R-biotin oligomer and 1 μM of lambda L oligomer in T4 DNA

(9) Cell cycle dynamics regulate H3K27 and H3K9 histone modifications in DrosophilaPLOS BiologyMarch 26, 2026Liyne Nogay, Ananthakrishnan Vijayakumar Maya, Lara Heckmann, Francesco Cardamone, Isabelle Grass, Aakriti Singh, Anna Frey, Laurin Ernst, Nicola Iovino, Anne-Kathrin ClassenNEBNext HighFidelity 2× PCR Master Mix with 1 pg of Tn5-tagmented lambda DNA (New England Biolabs, #N3011S) as a spike-in normalizer. The library indexing was performed using Illumina i5 and i7 [106] through

(10) In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and TestingbioRxivMarch 25, 2026Enrique O. Ruiz, Kayla Neyra, Diana M. Lopez, Ruo-Wen Chen, Deepta Paramasamy, Quincy Bizjak, Patrick D. Halley, Yin Wei, Marcos Sotomayor, Michael G. Poirier, et al.Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S). 1kb DNA ladder at 500 μg/mL (cat. #N3232S) was purchased from New England BioLabs

(11) Rad52 sorts and stacks Rad51 at the DNA junction to promote homologous recombinationbioRxivJanuary 16, 2026Jaigeeth Deveryshetty, Ayush Mistry, Sushil Pangeni, Mohamed Ghoneim, Monica Tokmina-Lukaszewska, Vikas Kaushik, Angela Taddei, Taekjip Ha, Brian Bothner, Edwin Antonybiotins on the 3′ and 5′ ends of the same strand. Lambda DNA was purchased from New England Biolabs (N3011). This linear DNA comes with 12 nucleotide (nt) 5′ overhangs. Three short oligos to anneal to the sticky

(12) Whole-genome profiling of age- and sex-associated DNA methylation signatures in human plasma cell-free DNACommunications MedicineNovember 28, 2025Wei Chen, Jinjin Xu, Guodan Zeng, Rijing Ou, Changlin Yang, Chuang Xu, Yeqin Wang, Xinxin Wang, Qiuyan Li, Chenhui Zhao, et al.(Zymo Research). To evaluate bisulfite conversion efficiency, 0.05 ng of lambda DNA (New England Biolabs, #N3011S) was added to each reaction as an unmethylated control before bisulfite treatment. Subsequently, WGBS

(13) CLAE: A High‐Fidelity Nanopore Sequencing Strategy for Read‐Level Viral Variant Detection and Environmental RNA Virus DiscoveryAdvanced ScienceNovember 1, 2025Hannah Yu, Sarah Golconda, Ga‐Eun Lee, Dantong Xue, Guillermo Domínguez‐Huerta, James M. Wainaina, Benjamin Bolduc, Shashanka Murthy, Shihyoung Kim, Seth Faith, et al.the manufacturer's protocol. Bacteriophage lambda DNA (cI857ind 1 Sam 7) was purchased from NEB (NEB N3011). The genomic DNA was fragmented using a g‐Tube (Fisher Scientific NC0380758) with the 20 Kb target

(14) Genome-wide profiling of unmodified DNA using methyltransferase-directed tagging and enrichmentCell Rep MethodsOctober 20, 2025Luca Tosti, Calum Mould, Imogen Gatehouse, Anthony C. Smith, Krystian Ubych, Valentina Miano, Peter W. Laird, Jack Kennefick, Robert K. NeelyQ33231 Novaseq 6000 - S4 (300 Cycle) Sequencing Kit,Illumina,cat#: 20028312 Lambda phage DNA,NEB,cat#: N3011L KAPA HyperPrep Library Prep,Roche,cat#: KK8504 8 microTube-50 AFA Fiber V2 Strips,Covaris,cat#: 520174 AMPure

(15) Cytosine methylase and hydroxymethylase activity in mammalian mitochondriaFront Cell Dev BiolOctober 15, 2025Lisa S. Shock, Prashant V. Thakkar, Jason M. Robinson, Shirley M. Taylorcat # 39649), and 5hmC antibody (Active Motif, cat # 39770). Lambda DNA (New England BioLabs, cat #N3011L) was sonicated using a Diagenode Bioruptor water bath sonicator at the highest pulse for 2 cycles of

(16) The Plasmodium CSP repeats have elastic properties with a critical role in sporozoite motilityThe EMBO JournalSeptember 22, 2025Amanda E Balaban, Sachie Kanatani, Jaba Mitra, Jason Gregory, Natasha Vartak, Ariadne Sinnis-Bourozikas, Fredrich Frischknecht, Taekjip Ha, Photini Sinnispairing with the DNA conjugated to the peptide. For fluorescence force experiments, 16 nM λ-DNA (NEB #N3011S) in 0.120 M NaCl was heated to 80 °C for 10 min followed by 5 min on ice. The Cy3-Cy5-peptide construct

(17) The Eukaryotic homology search complex distorts donor DNA structure to probe for homologybioRxivSeptember 3, 2025Mitchell V. Woodhouse, Jingyi Hu, Meiling Wu, Jin Qian, James T. Inman, Michelle D. Wang, J. Brooks Crickarda total length of 12,688 bp DNA center (77). The center segment was PCR amplified from λ-DNA (NEB, N3011S), then double digested with AvaI (NEB, R0152S) and BssSI-v2 (NEB, R0680S) to produce the unique overhangs

(18) DNA Dynamics in Dual Nanopore Tug-of-WarArXivAugust 28, 2025Zezhou Liu, Wangwei Dong, Thomas St-Denis, Matheus Azevedo Silva Pessôa, Sajad Shiekh, Preethi Ravikumar, Walter Reisnerin the SiN membrane at the channel tips using focused ion beam (FIB). DNA samples The λ-DNA (cat. N3011S) is commercially available from the New England Biolabs®and the T4 GT7 DNA (cat. 318–03971) is available

(19) Single-molecule tweezers decode hidden dimerization patterns of membrane proteins within lipid bilayersNat CommunAugust 9, 2025Victor W. Sadongo, Eojin Kim, Seoyoon Kim, W. C. Bhashini Wijesinghe, Taeseung Lee, Jeong-Mo Choi, Duyoung Minbiotins (2×biotin), were generated using polymerase chain reaction (PCR) with λ DNA template (NEB, N3011S) and synthesized primers (IDT). The primers used in the PCR were a forward primer (ACAGAAAGCCGCAGAGCA)

(20) Functional interplay between condensin I and topoisomerase Iiα in single-molecule DNA compactionNat CommunAugust 6, 2025Yuko Tsubota, Keishi Shintomi, Kazuhisa Kinoshita, Yuki Masahara-Negishi, Yuuki Aizawa, Masami Shima, Tatsuya Hirano, Tomoko Nishiyamawithdraw solutions. The channels were washed with ELB + +. Biotin-conjugation at both ends of λDNA (N3011, New England Biolabs) was performed as follows: 0.15 pmol λDNA and two biotinylated oligonucleotides,

Be the First to Write a Review!

Lambda DNA

Lambda DNA from New England Biolabs

Description

New England Biolabs

Citations (142)

Reviews

Lambda DNA from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map