Deoxynucleotide (dNTP) Solution Mix N0447S from New England Biolabs

Product Specs
ItemDeoxynucleotide (dNTP) Solution Mix
CompanyNew England Biolabs
Price $69.00 Inquire
Catalog NumberN0447S
Size8 µmol
Molecule NameDeoxynucleotide
ApplicationsDNA Analysis
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Protocol for flash-freezing, pooling, and preparing single nuclei suspensions from amniote inner-ear sensory epitheliaSTAR ProtocAugust 18, 2026Jimena Perez Lloret, Valeria Carolina Castagna, Marcela Lipovsek"RNase Inhibitor, Murine",New England Biolabs,M0314S Deoxynucleotide (dNTP) Solution Mix,New England Biolabs,N0447S Betaine solution,Sigma-Aldrich,B0300-1VL Human kidney total RNA,ThermoFisher,QS0616 KAPA HiFi HotStart ReadyMix

(2) Click-code-seq protocol for genome-wide single-nucleotide-resolution mapping of major types of DNA modificationsSTAR ProtocAugust 10, 2026Lucie Lefevre, Emilie A. Aghajani, Navnit K. Singh, Livia Maria Anna Pietrow, Nikolai J.L. Püllen, Vakil Takhaveev, Shana J. Sturla(THPTA),Lumiprobe,Cat#F4050 Dimethyl sulfoxide (DMSO),Sigma-Aldrich,Cat#W387520 Deoxynucleotides (dNTPs) solution mix,NEB,Cat#N0447S β-Nicotinamide adenine dinucleotide (NAD+),NEB,Cat#B9007S Magnesium Sulfate (MgSO4) Solution,NEB,Cat#B1003S Tween 20

(3) Divergent somatic mutation patterns among human cerebellar neuron typesNeuronAugust 10, 2026Marta Grońska-Pęski, Amoolya Srinivasa, Gilad D. Evrony‘V’ is a mixture of A, C, or G; IDT, ordered with HPLC purification), 4 μL of 10 mM dNTP mix (NEB, N0447S), and 44.25 μL NFW. After LCM, samples were centrifuged at 21,130 x g at 4 °C for 5 min, and the volume

(4) Single-nucleotide RNA m6A mapping in bovine preimplantation development reveals site-specific regulation of RPL12 at zygotic genome activationCell ReportsJuly 28, 2026Rajan Iyyappan, Yichi Niu, Yang Li, Hao Ming, Kinga Pajdzik, Noah R. Rakestraw, Piyush K. Jain, Chuan He, Chenghang Zong, Zongliang Jiang18090010) with a multiplexed pool of gene-specific reverse primers and dNTP mix (New England Biolabs, Cat# N0447S). Target regions were amplified using NEBNext Ultra II Q5 Master Mix (New England Biolabs, Cat# M0544)

(5) Introducing Borsantrazole: A Trifunctional Boron-Based Pyrazole That Extends the Lifespan of Amyotrophic Lateral Sclerosis MiceAdv Sci (Weinh)July 26, 2026Nitesh Sanghai, Rhonda Kelley, Ying Lao, M. Immanuel Reyes Madlangsakay, Prasanta Paul, M. Alejandra Llanes-Cuesta, Jun-Feng Wang, René P. Zahedi, Jiming Kong, Geoffrey K. TranmerPhusion HF reaction buffer from the PCR kit, about 0.5 µL of about 10 mM dNTPs (New England Biolabs, N0447S), 1.25 µL of about 10 µm forward primer (5’‐CATCAGCCCTAATCCATCTGA‐3’) (Fisher, 10336022), about 1.25

(6) Ketamine persists within neuronal compartments long after systemic clearanceResearchSquareJuly 22, 2026Joseph Cichon, Kallol Bera, Zachary Blumenfeld, Elaine Lin, Meah Ahmed, Eve Fine, Md. Nadim Hossain, Andrey Andreev, Altyn Rymbek, Peter Fenton, et al.Agarose,QIAGEN,ID. 30210,Protein purification Phusion polymerase,NEB,M0530S,For PCR dNTP mixture,NEB,N0447S,For PCR Kanamycin sulfate,Millipore-Sigma,K4000,For bacterial culture Ampicillin sodium salt,Sigma-Aldrich,A9518,For

(7) Isotope-free mapping of protein-RNA interactions at single-nucleotide resolution by iCLIP3STAR ProtocJuly 17, 2026Vladimir Despic, Melina Klostermann, Anna Orekhova, Mikhail Mesitov, Anke Busch, Kathi Zarnack, Julian König, Michaela Müller-McNicollFisher Scientific,Component of Cat#18080044 "Deoxynucleotide (dNTP) Solution mix, 10 mM each",NEB,Cat#N0447S HEPES Buffer Solution (1 M),Sigma-Aldrich,Cat#H0887-20ML "Sodium Hydroxide, pellet",Sigma-Aldrich,Cat#S8045-500G Buffer

(8) The MIRO1-BAX Complex Dictates Life and Death at the Mitochondrial GatebioRxivJuly 1, 2026Alva G. Sainz, Chulhwan S. Kwak, Kwang Bog Cho, Sejal A. Sripadanna, Brandon H. Bergsneider, Zoe Zizzo, Aarooran S. Durairaj, Zehui Du, Ian Cooney, Anthony Venida, et al.Gibson Assembly Master Mix: 100 uL 5×ISO buffer (250 μL 1 M Tris pH 7.5, 12.5 μL 2 M magnesium chloride, 50 μL 10 mM dNTP (N0447S, NEB), 0.125 g PEG-8000 (V3011, Promega), 25 μL 100 mM NAD+ (B9007S, NEB), 25 μL 1 M DTT, add millipore

(9) High-throughput Profiling of Pseudouridines in Microbiome-derived Bacterial RNACurr ProtocJuly 1, 2026Shikha Sharma, Ning Duan, Akintunde Emiolauntreated, RNA (Basic Protocol 2)50 µM random hexamers (IDT)Deoxynucleotide (dNTP) Solution Mix (NEB, N0447S)DEPC‐treated nuclease‐free water (Thermo Fisher Scientific, AM9920)SuperScript IV Reverse Transcriptase

(10) Four-dimensional molecular mapping from a spatial snapshot reveals the dynamics of hair follicle organogenesisCellJuly 1, 2026Soichiro Asami, Chenshuo Yin, Jean Fan, Luis A. Garza, Reza Kalhor(TEMED)",Sigma-Aldrich,#T7024-50ML Ammonium persulfate (APS),Sigma-Aldrich,#A3678-100G Deoxynucleotide (dNTP),New England Biolabs,#N0447S "N,N’-(1,2-dihydroxyethylene)bisacrylamide (Trolox)",Sigma-Aldrich,#294381-5G Beta-mercaptoethanol,Sigma-Aldrich,#M6250 5-AA-2’-dUTP,TriLink,#N-2049 DAPI,Invitrogen,#D1306 Salmon

(11) Recombinant Protein Expression in Rhodococcus speciesCurrent ProtocolsJuly 1, 2026Michael Akintubosun, Melanie A. Higgins(e.g., Q5 High‐Fidelity DNA Polymerase, NEB, cat. no. M0491)dNTP mixture, 10 mM each (NEB, cat. no. N0447S)Nuclease‐free water (Ambion, cat. no. AM9937)Agarose gel loading dye (e.g., 6× Gel Loading Dye, NEB,

(12) A recombinant dilp2GS-rpr donor line for adult-inducible IPC ablation across Drosophila genetic backgroundsbioRxivJune 24, 2026Yuyan Chen, Yulin Bai, Xuan Zhuangwere performed using OneTaq® DNA Polymerase (NEB, M0480) and Deoxynucleotide (dNTP) Solution Mix (NEB, N0447S) according to the manufacturer’s instructions. Amplified products (328 bp for dilp2GS-GAL4 and 805 bp

(13) Systematic benchmarking of dorado basecalling models for RNA modification detection with highly multiplexed nanopore sequencingNucleic Acids ResJune 17, 2026Gregor Diensthuber, Ivan Milenkovic, Laia Llovera, Ana Milovanovic, Francesco Pelizzari, Eva Maria Novoakit. For the reverse transcription reaction, 50 ng of input RNA was combined with 1 µl of dNTPs (NEB, N0447S), and 1 µl of the CRTA primer (2 µM, 5′-ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTT-3′) in a total volume of 11

(14) Differential A-to-I editing of SINE B2 RNAs unveils an epitranscriptome response to Aβ neurotoxicityLife Sci AllianceJune 16, 2026Liam Mitchell, Luke Saville, Babita Gollen, Travis Haight, Riya Roy, Cody Turner, Yubo Cheng, Igor Kovalchuk, Majid H Mohajerani, Athanasios Zovoilisfirst-strand synthesis reaction was constructed from the ligation product by adding 9 μl H2O, 2 μl dNTP mix (N0447S; NEB), 8 μl FS buffer (18080093; Invitrogen), 4 μl 0.1 M DTT (18080093; Invitrogen), and 2 μl Superscript III reverse transcriptase

(15) The anti-inflammatory efficacy of melanocortin drugs is influenced by genetic variation at MC1RScientific ReportsJune 11, 2026Natalya Khodeneva, Camilla S. A. Davan-Wetton, Thomas E. N. Jonassen, Mauro Perretti, Trinidad Montero-Melendezamplified using the TaKaRa Taq PCR kit (TaKaRa, Cat#639209) with 0.6 mM NEB dNTPs (New England Biolabs, Cat#N0447S). PCR products were purified and subjected to Sanger sequencing at Eurofins Genomics service (Ebersberg,

(16) Genetic Diversity and Population Structure of the Black-Footed Cat: Insights into Felis's Deadliest PredatorbioRxivJune 2, 2026Victoria Belle Grant, Kelsie Hunnicutt, Michelle Schroeder, Martina Küsters, Jonas Oppenheimer, Shreya Banerjee, John J. Baczenas, Dmitri Petrov, Jacqueline M. Bishop, Nadine Lamberski, et al.amplified the sample with 14 μL Phusion PCR mix (HF buffer [NEB, B0518S], custom index primer, dNTPs [N0447S], Phusion High-Fidelity DNA Polymerase [NEB, M0530]) for 12 cycles. After the PCR run, we purified the

(17) Targeted KRASG12V Degradation in vivo Elicits Lung Adenocarcinoma Regression with Subsequent Relapse from Dysregulated ProteolysisCancer ResMay 27, 2026Alberto Martín, Inés M. García-Pérez, Sonia San José, Pep Rojo, Carlos Riego-Mejías, Cristina Teodosio, Bárbara MG. Barbosa, Carolina Sánchez-Zarzalejo, Ignasi Folch-I-Casanovas, Antonia Odena Caballol, et al.0.25µL Q5 high-fidelity DNA polymerase (#M0491L, New England Biolabs), 5µL 5X buffer, 0.5µL dNTP mix (#N0447S, Thermo Scientific), 1.25µL of 100mM forward primer (CAAGCCTCCGGAGCGCACG), 1.25µL of 100mM reverse primer

(18) Low-Abundance and Fragmentary Helicobacter pylori DNA Detected in Phenotypically Negative Gastric Biopsies Using Targeted SequencingBiomoleculesMay 22, 2026Fabien Mbaya-Tshibangu, Alain Cimuanga-Mukanya, Evariste Tshibangu-Kabamba, Nadine Kayiba-Kalenda, Tressy Kalenga-Ngomba, Patrick de Jesus Ngoma-Kisoko, Gunturu Revathi, Junko Akada, Benoît Mbiya-Mukinayi, Augustin Tshibaka Kabongo, et al.(New England Biolabs, Ipswich, MA, USA, M0269L), 1× phi29 reaction buffer, 1 mM each dNTP (NEB, Ipswich, MA, USA, N0447S), 0.1 mg/mL bovine serum albumin (NEB, Ipswich, MA, USA, B9200S), and 10 µM of each sWGA primer. Reactions

(19) An In Vitro A-431 Epithelial Cell Infection Model for Studying Fungal Pathogenicity and Immune Responses Associated With Vulvovaginal CandidiasisBio ProtocMay 20, 2026Victoria E. Groß, Kar On Cheng, Beatriz Cristóvão, Ezgi Gürel, Maximilian Himmel, Candela Fernández-Fernández, Jördis V. Schuchardt, Axel Dietschmann, Dolly E. Montaño, Mark S. Gresnigtcatalog number: A6002) 23. Deoxynucleotide (dNTP) solution mix (New England BioLabs Inc., catalog number: N0447S) 24. RNaseOUTTM recombinant RNase inhibitor (Invitrogen, catalog number: 10777-019) 25. SuperScriptTM

(20) A combinatorial domain screening platform reveals epigenetic effector interactions for transcriptional perturbationNature CommunicationsApril 24, 2026Hyungseok C. Moon, Michael H. Herschl, Alessandra Sclip, Vincent Q. Tran, April Pawluk, Silvana Konermann, Patrick D. Hsucleanup was performed before dA tailing using Taq polymerase (34 μL eluate, 1 μL 10 mM dNTP mix (NEB, N0447S), 1 μL Taq polymerase (NEB, M0267S), and 4 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 72 °C

Be the First to Write a Review!

Deoxynucleotide (dNTP) Solution Mix

Deoxynucleotide (dNTP) Solution Mix from New England Biolabs

Description

New England Biolabs

Citations (321)

Reviews

Deoxynucleotide (dNTP) Solution Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map