Fig 1: Gene expression and proliferation in MSC exosome–treated organoids. (A) Images of green fluorescent protein-positive colon organoids cultured with a mock control containing vesicle-free fetal calf serum for 1 week. Images are representative of 2 independent experiments. (B) Representative images of colon organoids cultured without and with MSC exosomes for 72 hours. To obtain colon organoids, after killing the mice, the colonic tissue was transferred to 20 mmol/L EDTA (324503; Merck Millipore) in Hanks’ balanced salt solution (14175-053; Gibco) and incubated for 30 minutes at 37°C with repeated vortexing to release the colonic crypts. The crypts were washed in Ad-DF+++, consisting of Advanced Dulbecco's modified Eagle medium/Ham’s F-12 (12634-010; Gibco) supplemented with 1% Glutamax (35050-038; Gibco), 1% penicillin/streptomycin (15140-122; Gibco) and 1% HEPES (15630-056; Gibco). After centrifugation, the colonic crypts were plated in 20 μL Matrigel (growth factor–reduced Matrigel, 356231; Corning, Corning, NY) in 48-well culture plates. After polymerization of the Matrigel, 250 μL of complete growth medium was added, consisting of Ad-DF+++, supplemented with B27 (11530536; Invitrogen, Carlsbad, CA), N-acetylcysteine (A9165-5; Sigma-Aldrich), nicotinamide (n0636; Sigma-Aldrich), A83-01 (2939; Tocris, Bristol, UK), p38 inhibitor (s7067; Sigma-Aldrich), epidermal growth factor (PMG8041; Invitrogen), 20% Noggin CM, 10% R-spondin CM (both kindly provided by the Tytgat Institute, Amsterdam, The Netherlands), and 50% Wnt3a CM (kindly provided by the Hubrecht Institute, Utrecht University, The Netherlands). During the first 4 days, medium was supplemented with Rho-K inhibitor (Y0503; Sigma-Aldrich). Colonic organoids were maintained in a humidified incubator at 37°C containing 5% CO2. (C) H&E and Ki67 staining of colon organoids cultured with exosomes or phosphate-buffered saline (PBS) for 72 hours. Colonic organoids treated with or without exosomes were stained immunohistochemically for the proliferation marker rabbit anti-Ki67 (clone SP6, 16667; Abcam) as described before.1 (D) Relative messenger RNA expression of LGR5, chromogranin A (ChgA), cytokeratin 20 (CK20), cyclo-oxygenase-2 (COX-2), and mucin (MUC2) in dissociated colon organoids co-cultured with PBS or exosomes for 24 and 72 hours. Data represent the means of 3 independent experiments performed in triplicate. The Student t test was used. Messenger RNA was isolated using the nucleospin RNA kit (740955250; Macherey-Nagel, Düren, Germany) after 24 and 72 hours. Complementary DNA was generated using the RevertAid First Strand Complementary DNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s protocol. Quantitative polymerase chain reactions were performed using SYBR green (1708886; Bio-Rad, Hercules, CA) and primers (all Invitrogen) for a stem cell marker (leucine-rich repeat-containing G-protein–coupled receptor 5: forward: TGGTGGCTTTGACCGTGTT; reverse: CGATTACCCCAATTAGCAGCTTT), differentiation markers (mucin 2: forward: CCCAGAGAGTTTGGAGAGCA; reverse: CTCCTCACATGTGGTCTGGT; chromogranin A: forward: GGCCCAGCAGCCGCTGAAGCAGCA; reverse: CTCTGCGGTTGGCGCTGCCCTCCTC; cytokeratin 20: forward: CGCATCTCTGTCTCCAAAGC; reverse: TTCTGCATTGCCAGTTTCCC), and the prostaglandin pathway (cyclo-oxygenase 2: forward: CCGTGCTGCTCTGTCTTAAC; reverse: TTGGGAACCCTTCTTTGTTC). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene: forward: AACTTTGGCATTGTGGAAGG; reverse ACACATTGGGGGTAGGAACA. **P < .01, ****P < .0001.
Fig 2: Kcr is reduced at DNA damage sites in an HDAC-dependent manner. (A and B) Representative images of U2OS cells that were exposed to laser microirradiation and 5 min later fixed and costained using the following antibodies: pan crotonyllysine (PTM-BIO; PTM-501, Zhejiang, China), crotonylated H3K9 (PTM-BIO; PTM-516), and γH2AX (Cell Signaling; 2577, Danvers, MA, USA). DNA was stained with DAPI (blue). Results are typical of four independent experiments (n > 50). The percentage of cells showing colocalization of the indicated markers is written on the right. Scale bar is equal to 2 μm. (C–E) show H3K9cr levels at different time points after DNA damage induced by IR (10 Gys; C), UV (10 J/m2; D), and VP16 (40 μm; 30 min; E). Histones were prepared by acidic extraction and subjected to western blot analysis. Histone H3 (Abcam; ab1791, Cambridge, MA, USA) is used as a loading control. γH2AX is used as a marker for DNA damage induction. The numbers below the blots indicate the ratio between the intensities of H3K9cr and total H3 bands, which was normalized to the untreated samples and averaged from three independent experiments. Band quantification was performed using ImageJ software. (F) Western blot shows the levels of H3K9cr after treatment with 5 mM NAM for 4 h (Sigma; N0636, Rehovot, Israel) or 1 μm TSA (Sigma; T1952) for 2 h. (G) as in E except for pretreating the cells either with DMSO or NAM prior to VP16 treatment. (H and I) as in D and E except for pretreating the cells either with DMSO or TSA prior to DNA damage induction. The two antibodies used in this study, pan crotonyllysine (PTM-501) and crotonylated H3K9 (PTM-516), have been tested for their selectivity and specificity by at least two independent groups (Tan et al., 2011; Andrews et al., 2016). Bands quantification was performed as described above.
Supplier Page from MilliporeSigma for Nicotinamide