CytoTox-Glo Cytotoxicity Assay G9291 from Promega

Product Specs
ItemCytoTox-Glo Cytotoxicity Assay
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberG9291
Detection TargetCytotoxicity
MethodAssay
Quantity5 x 10ml

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) IFNγ-induced antigen loss in chimeric antigen receptor-T cell therapyFrontiers in ImmunologyMarch 17, 2026Miao Cao, Jasmine Alvarez, Ramkrishna Mitra, Michael Xu, Trevor R. Baybutt, Zhengyang Sun, Oluwatobiloba Taylor, Allison S. Doermann, Ross E. Staudt, Scott A. Waldman, et al.times. Cell culture supernatant and cells analyzed using the CytoTox-Glo Cytotoxicity Assay (Promega, G9290). Viable cell luminescence was calculated by subtracting dead cell luminescence (supernatant) from the

(2) IFNγ-induced antigen loss in chimeric antigen receptor-T cell therapyFront ImmunolMarch 17, 2026Miao Cao, Jasmine Alvarez, Ramkrishna Mitra, Michael Xu, Trevor R. Baybutt, Zhengyang Sun, Oluwatobiloba Taylor, Allison S. Doermann, Ross E. Staudt, Scott A. Waldman, et al.times. Cell culture supernatant and cells analyzed using the CytoTox-Glo Cytotoxicity Assay (Promega, G9290). Viable cell luminescence was calculated by subtracting dead cell luminescence (supernatant) from the

(3) GSPT1-specific protein degradation is effective in preclinical models of chemoresistant MYCN-amplified neuroblastomaJournal of Experimental & Clinical Cancer ResearchFebruary 6, 2026Aleksandra Adamska, Hanna Chahin, Erick Andrés Muciño-Olmos, Javanshir Esfandyari, Kristina Aaltonen, Sofia Granados-Aparici, Joachim Tetteh Siaw, Katarzyna Radke, Chiara Lago, Paweł Pasikowski, et al.MGs for the next 48 h. Cell viability and cell death were measured using CytoToxGlo kit (Promega, #G9292) according to the manufacturer’s instructions. Luminescence was measured with a Synergy2 Multi-Mode

(4) Nicotinamide counteracts Rotenone-induced mitochondrial and neuronal dysfunction in a translational early-life modelScientific ReportsFebruary 4, 2026Amanda Siena, Luiz Felipe Luiz Felipe Souza, Vitória Cristina Araujo, Martina Raissa Ribeiro, Larissa de Sá Lima, Diana Zukas Andreotti, Ana Maria Orellana, Elisa Mitiko Kawamoto, Pedro Ismael Silva Junior, Cristoforo Scavone, et al.duplicate). As a confirmatory method, we employed the CytoTox-Glo™ Cytotoxicity Assay kit (Promega, cat. G9290)33 (n = 5 in duplicate). In both assays, data are expressed as mean ± standard error of the mean (SEM)

(5) Immunostimulatory nucleic acid nanoparticles establish antiviral state to inhibit viral infection and replicationJournal of VirologyFebruary 3, 2026Martin Panigaj, Cassandra Catacalos-Goad, Anh Ha, Valery Z. Grdzelishvili, Kirill A. Afoninplate at a 1:1 ratio to measure cell cytotoxicity using the CytoTox-Glo Cytotoxicity Assay (Promega, G9290). After a 20-min incubation at room temperature, the luminescence was measured using a luminometer (ns,

(6) Fostamatinib (R788), a spleen tyrosine kinase inhibitor, sensitizes pancreatic cancer cells to oncolytic vesicular stomatitis virusMolecular Therapy OncologyDecember 18, 2025Cassandra Catacalos-Goad, Dakota W. Goad, Molly C. Holbrook, Quinton Krueger, Isha M. Wilson, M. Abdul Hajjar, Valery Z. Grdzelishviliplate at a 1:1 ratio to measure cell cytotoxicity using the CytoTox-Glo Cytotoxicity Assay (Promega, G9290). After a 20-min incubation at room temperature, the luminescence was measured using a luminometer.

(7) P329G-engager: a universal mix & match antibody-based adaptor platform for cancer immunotherapyMAbsDecember 16, 2025Marlena Surowka, Diana Darowski, Idil Hutter-Karakoc, Christina Claus, Claudia Ferrara-Koller, Anne Freimoser-Grundschober, Thomas Hofer, Johannes Sam, Reto Gianotti, Andrzej Sobieniecki, et al.staining. Cytotoxicity representing dead cell proteases was measured with a Cytotox-Glo kit (Promega #G9291), according to manufacturer’s protocol, and read with a Tecan Spark 10 M reader. The luminescent signal

(8) Developing SEMA4A-directed CAR T cells to overcome low BCMA antigen density in multiple myelomaCancer CellDecember 8, 2025Francesco Di Meo, Francesca Albano, Annamaria Cesarano, Yunfei Wang, Brandon Kale, Kenneth Shain, Ariosto Silva, Noriyoshi Kurihara, Hirofumi Tenshin, David Jellyman, et al.cell Isolation Kit II, mouse",Miltenyi Biotec,Cat# 130-095-130 CytoTox-Glo™ Cytotoxicity Assay,Promega,Cat# G9290 Human Kappa ELISA Kit,Bethyl Laboratories,Cat# E88-115 Human Lamda ELISA Kit,Bethyl Laboratories,Cat#

(9) EGFR amplification and PI3K pathway mutations identify a subset of breast cancers that synergistically respond to EGFR and PI3K inhibitionOncogeneNovember 25, 2025David J. Wisniewski, Donna Voeller, Yonit A. Addissie, Sachin Kumar Deshmukh, Sharon Wu, Maryam B. Lustberg, Darawalee Wangsa, Danny Wangsa, Kerstin Heselmeyer-Haddad, Yoshimi Endo Greer, et al.Genomics Core at the National Cancer Institute. Cell death Cell death was determined by CytoTox-Glo (G9291) as directed by Promega or by propidium iodide uptake. Propidium iodide (PI) staining, imaging and quantification

(10) Peptide-based inhibition of CD44v6 renders liver carcinomas more susceptible to therapeutic interventionJournal of Molecular MedicineOctober 31, 2025Akshaya Srikanth, Ranjitha Vishnu Anand Rao, Rui Dong, Umesh Tharehalli, Thomas F. E. Barth, Klaus Dembowsky, Thomas Seufferlein, Reinhold Schirmbeck, André LechelAMC303 and gemcitabine. The cell viability was measured using the CytoTox-Glo™ Cytotoxicity Assay (G9290, Promega) as per the manufacturer’s instructions. Statistical analysis All experiments were performed

(11) Gasdermin C cleavage by Cathepsin S modulates Rab7 vesicles in intestinal epithelial cells to amplify anti-helminth immunityImmunityOctober 14, 2025Surya P. Pandey, Donghui Yang, Lee Hedden, Colin R. Laughlin, Weihong Wang, Ariadna S. Soto, Halah Winner, Luzmariel Medina Medina Sanchez, Edith E. Campana, Clarisse Engl, et al.Kit,Qiagen,Cat# 51604 Nile Red Staining Kit,Abcam,Cat# 228553 CytoTox-Glo™ Cytotoxicity Assay,Promega,Cat# G9290 Zymo Research Corporation Quick-DNA™ Miniprep Plus Kit,Zymo Research,Cat# D4069 QIAprep Spin Miniprep

(12) Developing inhibitors of the guanosine triphosphate hydrolysis accelerating activity of Regulator of G protein Signaling-14Journal of Biological ChemistryOctober 1, 2025Percy S. Agogo-Mawuli, Isra Sadiya, Tigran M. Abramyan, Dustin E. Bosch, Kyle A. Emmitte, Luis M. Colón-Pérez, Mickey Kosloff, David P. Siderovskiincubated overnight at 37 °C in a humidified 5% CO2 incubator. For the CytoTox-Glo assay (Promega, Cat# G9291), 50 μl of assay reagent was added to each well. Plates were mixed briefly, sealed, and incubated at

(13) Chronic antigen stimulation in melanoma induces T cell exhaustion and limits efficacy of T cell bispecific therapiesOncoimmunologyAugust 26, 2025Idil Hutter-Karakoc, Eleni Maria Varypataki, Aparna Neelakandhan, Simone Lang, Vesna Kramar, Ahmet Varol, Sasha Simons, Marine Richard, Mudita Pincha, Dario Venetz, et al.methods. Tumor cell killing – luminescence-based cytotoxicity assay Promega Cytotox-Glo™ (Promega, G9291) was used to measure tumor cell lysis by detecting dead cell protein release. After 24–48 h of killing

(14) Dual inhibition of EGFR and PI3Kinase signaling in EGFR amplified triple negative breast cancer cells induces apoptosis and reduces tumor growthbioRxivJune 7, 2025David J. Wisniewski, Donna Voeller, Yonit A. Addissie, Sachin Kumar Deshmukh, Sharon Wu, Maryam B. Lustberg, Darawalee Wangsa, Danny Wangsa, Kerstin Heselmeyer-Haddad, George W. Sledge, et al.(AAGATTTGCTGAACCCTATTG); exon 20 sequencing primer (TCGTCACAATAGTAACATCATGG). Cell Death CytoTox-Glo (G9291) was performed as directed by Promega. Briefly, cells were pretreated with 20 μM ZVAD for 1 hour, followed

(15) METTL3 depletion blocks vesicular stomatitis virus replication in pancreatic cancer cells through the establishment of an intrinsic antiviral stateJournal of VirologyMay 20, 2025Cassandra Catacalos-Goad, Jacob Hawkins, Quinton Krueger, Nathaniel Foret, Valery Z. Grdzelishviliread at 450 nm using a multi-well plate reader. For cell cytotoxicity, CytoTox-Glo reagent (Promega, G9290) was added to each well for 15 min at room temperature, then luminescence was measured. Alternatively,

(16) ST6GalNAc-I regulates tumor cell sialylation via NECTIN2/MUC5AC-mediated immunosuppression and angiogenesis in non-small cell lung cancerJ Clin InvestMay 15, 2025Muthamil Iniyan Appadurai, Sanjib Chaudhary, Ashu Shah, Gopalakrishnan Natarajan, Zahraa W. Alsafwani, Parvez Khan, Dhananjay D. Shinde, Subodh M. Lele, Lynette M. Smith, Mohd Wasim Nasser, et al.live-cell imaging system. In addition, we measured cytotoxicity in 48-hour cocultures using a CytoTox-Glo (catalog G9290, Promega) kit for luminescence. The luminescence signal generated from control cells and T cells was

(17) Sustainable Nonwoven Scaffolds Engineered with Recycled Carbon Fiber for Enhanced Biocompatibility and Cell Interaction: From Waste to HealthACS Applied Bio MaterialsMarch 17, 2025Jonas Naumann, Kresten Singer, Siddharth Shukla, Alok Maurya, Stefan Schlichter, Imre Szenti, Akos Kukovecz, Amit Rawal, Mareike ZinkReader Synergy H1 (Agilent Technologies, Santa Clara, CA) using the CytoTox-Glo Cytotoxicity Assay (G9292, Promega, Madison, WI). All three previously mentioned nonwovens, with a size of 0.25 cm2, were used.

(18) The EMCV protein 2B* is required for efficient cell lysis via both caspase-3-dependent and -independent pathways during infectionJ Gen VirolFebruary 10, 2025Samantha K. Nguyen, Edward Long, James R. Edgar, Andrew E. Firth, Hazel Stewartby plaque assay. Luciferase-based cytotoxicity assay The CytoTox-Glo™ Cytotoxicity Assay (Promega, G9291) was used for these experiments. BHK-21 cells were seeded at ~30% confluency in 10-cm dishes. After

(19) KDM2B regulates stroke injury by modulating OGT-mediated 0-GlcNAcylation of SLC7A11Communications BiologyNovember 18, 2024Yi Li, Liangbo Niu, Dai Zheng, Xinxing Zhang, Lu Feng, Jing Fuconducted thrice. CytoTox-Glo™ cytotoxicity assay Cell viability was determined using CytoTox-Glo (G9290, Promega, Mannheim, Germany). This assay measures the dead-cell protease activity, which is released

(20) Enhancing RNA inhibitory activity using clamp-G-modified nucleobasesCell Reports Physical ScienceAugust 21, 2024Sai Pallavi Pradeep, Vikas Kumar, Shipra Malik, Frank J. Slack, Anisha Gupta, Raman Bahalof incubation, CytoTox-Glo reagent was added according to the manufacturer’s instructions (Promega, #G9290). Luminescence from dead cells was measured on an infinite 200 PRO microplate reader (TECAN). Apoptosis assay

Write a Review

(1)

6/13/2023Easy to Use Cytotoxicity Assay Yao WangWe used this kit to measure the cell viability in response to various treatment. We used many different types of cell, from tumor cell lines to mouse primary cells. This kit always gave us stable ... Read Review
(1)

4/10/2019Very Easy-to-Use Kit Elena SeranovaAn easy-to-use kit, would recommend to users with limited lab experience (undergrad students) to measure cytotoxicityIts slightly harder to run the assay on iPSCs as they grow in colonies and you need... Read Review

CytoTox-Glo Cytotoxicity Assay

CytoTox-Glo Cytotoxicity Assay from Promega

Description

Promega

Citations (73)

Reviews

CytoTox-Glo Cytotoxicity Assay from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map