Human IL-29/IFN-lambda 1 DuoSet ELISA DY7246 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemHuman IL-29/IFN-lambda 1 DuoSet ELISA
CompanyR&D Systems, a Bio-Techne Brand
Price $890.00Supplier Page View Company Product Page
Catalog NumberDY7246
Quantity1 Kit (for 15 Plates)
ApplicationsELISA
Detection Range62.50 - 4000 pg/mL
ReactivityHuman
Detection TargetIL-29/IFN-lambda 1
StorageStore the unopened product at 2 - 8 °C. Do not use past expiration date
NCBI Full Gene Nameinterferon lambda 1
NCBI Gene AliasesIL-29, IL29

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Basal IFNλ2/3 signaling is required for ISG expression and viral control in human intestinal epithelial cellsPLOS PathogensJanuary 12, 2026Yagmur Keser, Zehra Sena Bumin, Amelia Perez Valiente, Sorin O. Jacobs, Steeve Boulant, Megan L. Staniferand detection antibodies provided in the corresponding DuoSet ELISA kits (R&D Systems, Bio-Techne # DY7246, #DY1587, # DY5259). For each interferon, neutralization was performed individually. Capture and detection

(2) Dynamics of Cytokines and Chemokines During the Peripartum Period in People Living With Human Immunodeficiency VirusAm J Reprod ImmunolAugust 22, 2025Jacqueline Corry, Natalia Zotova, Martine Tabala, Christina K. Cotrone, Fidéle Lumande Kasindi, Bienvenu Lebwaze Massamba, Pelagie Babakazo, Namal P. M. Liyanage, Nicholas T. Funderburg, Marcel Yotebieng, et al.factors were individually measured by duoset ELISA (R&D Systems): CXCL13 (DY801), IL‐4 (DY204), IFN‐λ‐1(DY7246), soluble monocyte differentiation antigen CD14 (sCD14, DY383), soluble scavenger receptor cysteine‐rich

(3) IFNλ1 is a STING-dependent mediator of DNA damage and induces immune activation in lung cancerFront ImmunolFebruary 12, 2025Stine Høvring Godsk, Caroline Maren Stengaard Jensen, Trine Vilsbøll Larsen, Johanne Ahrenfeldt, Kristine Raaby Gammelgaard, Martin Roelsgaard Jakobsenand IL-6 in supernatants was caried out using Human DuoSet ELISA (R&D systems, Cat#: DY278, DY814, DY7246, DY206) according to the manufacturer’s instructions. The optical density was determined using a microplate

(4) Reduced IFNL1 and/or IFNL2, but not IFNL3 is associated with worse outcome in patients with COVID-19Clinical and Experimental ImmunologyNovember 12, 2024Elena Woods, Adriana Mena, Sophie Sierpinska, Emily Carr, STTAR Bioresource, Richard Hagan, John Crowley, Colm Bergin, David Clark, Caroline Brophy, et al.100 μL EDTA plasma using the Duo Set ELISA kit according to manufacturer’s instructions (R&D Systems—DY7246, DY1587, DY5259, respectively). Each biological sample was assayed in duplicate. A standard curve was

(5) Early interferon lambda production is induced by double-stranded RNA in iPS-derived hepatocyte-like cellsOxford open immunologyJanuary 1, 2024Sularea VM, Sharma R, Hay DC, O'Farrelly C.assays,, Human IFN-β Duoset ELISA,R&D Systems,Cat# DY814-05 Human IL-29 (IFNL1) Duoset ELISA,R&D Systems,Cat# DY7246 Primers,, ,,Ifnb1 forward:5′- AAACTCATGAGCAGTCTGCA -3′Ifnb1 reverse:5′- AGGAGATCTTCAGTTTCGGAGG -3′ ,,Ifnl1

(6) The RIG-I agonist M8 triggers cell death and natural killer cell activation in human papillomavirus-associated cancer and potentiates cisplatin cytotoxicityCancer Immunology, ImmunotherapyJune 25, 2023Carlo Girone, Federica Calati, Irene Lo Cigno, Valentina Salvi, Valentina Tassinari, Tiziana Schioppa, Cinzia Borgogna, Ludovica Lospinoso Severini, John Hiscott, Cristina Cerboni, et al.enzyme-linked immunosorbent assay (ELISA) kits for IFN-β (DY814-05; DuoSet ELISA human IFN-β; R&D Systems), IFN-λ1 (DY7246; DuoSet ELISA human IL-29/IFN-λ1; R&D Systems), IL-6 (DY206-05; DuoSet ELISA human IL-6; R&D Systems),

(7) Analogous comparison unravels heightened antiviral defense and boosted viral infection upon immunosuppression in bat organoidsSignal transduction and targeted therapyDecember 19, 2022Liu X, Li C, Wan Z, Chiu MC, Huang J, Yu Y, Zhu L, Cai JP, Rong L, Song YQ, et al.intestinal organoids for measuring the amount of human IFNL1 and IFNL3 using ELISA kits (R&D Systems, DY7246, D28B00). Parallel reaction monitoring-mass spectrometry assay Cell-free media were harvested from

(8) Restoration of dendritic cell homeostasis and Type I/Type III interferon levels in convalescent COVID-19 individualsBMC immunologyOctober 26, 2022Rajamanickam A, Kumar NP, Pandiaraj AN, Selvaraj N, Munisankar S, Renji RM, Venkatramani V, Murhekar M, Thangaraj JWV, Kumar MS, et al.

(9) Serum IL-28A/IFN-λ2 is linked to disease severity of COVID-19Scientific reportsMarch 31, 2022Fukuda Y, Homma T, Inoue H, Goto Y, Sato Y, Ikeda H, Onitsuka C, Sato H, Akimoto K, Ebato T, et al.

(10) Dynamic innate immune response determines susceptibility to SARS-CoV-2 infection and early replication kineticsJournal of Experimental MedicineAugust 2, 2021Nagarjuna R. Cheemarla, Timothy A. Watkins, Valia T. Mihaylova, Bao Wang, Dejian Zhao, Guilin Wang, Marie L. Landry, Ellen F. Foxmanconcentration in culture basolateral media was measured using a commercial IFNλ1 ELISA kit (catalog no. DY7246; R&D Systems) or IFNβ ELISA kit (DY814-05; R&D Systems). Basolateral media from mock-infected and infected

(11) Robust innate immune responses at the placenta during early gestation may limit in utero HIV transmissionPLoS pathogensAugust 1, 2021Johnson EL, Swieboda D, Olivier A, Enninga EAL, Chakraborty R.and accompanying controls were assessed in duplicate using the Human IL-29/IFN-λ1 DuoSet ELISA Kit (DY7246; R&D Systems, Minneapolis, MN, USA) and the Human IFN-β ELISA Kit (41410; PBL, Piscataway, NY, USA)

(12) Human Placental Trophoblasts Infected by Listeria monocytogenes Undergo a Pro-Inflammatory Switch Associated With Poor Pregnancy OutcomesFrontiers in ImmunologyJuly 23, 2021Lauren J. Johnson, Siavash Azari, Amy Webb, Xiaoli Zhang, Mikhail A. Gavrilin, Joanna M. Marshall, Kara Rood, Stephanie SeveauV-PLEX Human Biomarker 54-Plex Kit (Meso Scale Discovery). IFNL1, IFNL2, and IFNL3 ELISAs were performed using the human IL-29 (DY7246), IL-28A (DY1587), and IL-28B (DY5259) DuoSet ELISA kits (R&D Systems) per the manufacturer’s instructions. Colocalization

(13) Mitochondrial CMPK2 mediates immunomodulatory and antiviral activities through IFN-dependent and IFN-independent pathwaysiScienceJune 25, 2021Lai JH, Wu DW, Wu CH, Hung LF, Huang CY, Ka SM, Chen A, Chang ZF, Ho LJ.CCL19/MIP-3β,PeproTech,Cat#250-27B ELISA Human IFN-α,PBL Assay Science,Cat#41100-1 ELISA Human IFN-λ1,R&D systems,Cat#DY7246 Human IL-1β Antibody (ELISA),R&D systems,"Cat# MAB601, RRID:AB_358545" Human IL-1β Biotinylated Antibody

(14) Impact of Inflammatory Immune Dysfunction in Psoriasis Patients at Risk for COVID-19VaccinesMay 10, 2021Yendo TM, Sato MN, Branco ACCC, Pietrobon AJ, Teixeira FME, Ramos YÁL, Alberca RW, Valêncio CG, Arruda VN, Romiti R, et al.IL-27 and IL-29 using DuoSet enzymelinked immunosorbent assay (ELISA) kits (codes: DY318-05, DY2526 and DY7246, respectively; R&D Systems, Minnesota, MN, USA) according to the manufacturer’s instructions. The minimum

(15) SARS-CoV-2 induces human plasmacytoid predendritic cell diversification via UNC93B and IRAK4The Journal of experimental medicineApril 5, 2021Onodi F, Bonnet-Madin L, Meertens L, Karpf L, Poirot J, Zhang SY, Picard C, Puel A, Jouanguy E, Zhang Q, et al.Array Software (BD Biosciences). The concentration of secreted IFN-λ1 was measured by ELISA (DuoSet DY7246; R&D Systems) according to the manufacturer’s instructions. The manufacturer reported neither cross-reactivity

(16) Aggressive PDACs Show Hypomethylation of Repetitive Elements and the Execution of an Intrinsic IFN Program Linked to a Ductal Cell of OriginCancer discoveryMarch 1, 2021Espinet E, Gu Z, Imbusch CD, Giese NA, Büscher M, Safavi M, Weisenburger S, Klein C, Vogel V, Falcone M, et al.ELISA kit (41410, pbl assay science), Human INFγ ELISA kit (EHIFNG, Invitrogen), Human IL-29/IFN-λ1 (DY7246, R&D Systems), and Human IL-28A/IFN-λ2 (DY1587, R&D Systems). Generation of knock-down cells STAT1

(17) SARS-CoV-2 induces human plasmacytoid pre-dendritic cell diversification via UNC93B and IRAK4bioRxiv : the preprint server for biologyJanuary 8, 2021Onodi F, Bonnet-Madin L, Meertens L, Karpf L, Poirot J, Zhang SY, Picard C, Puel A, Jouanguy E, Zhang Q, et al.concentration of secreted IFN-λ1 was measured by enzyme-linked immunosorbent assay (ELISA) (R&D Systems, DuoSet DY7246), according to the manufacturer’s instructions. The manufacturer reported neither cross-reactivity nor

(18) Inborn errors of type I IFN immunity in patients with life-threatening COVID-19Science (New York, N.Y.)October 23, 2020Zhang Q, Bastard P, Liu Z, Le Pen J, Moncada-Velez M, Chen J, Ogishi M, Sabli IKD, Hodeib S, Korol C, et al.protocol using a 20 pg/ml detection limit. IFN-l1 secretion was measured in an ELISA (R&D Systems, DuoSet DY7246), in accordance with the manufacturer’s instructions. 20 1.0 0.5 A D A D (NM_005419.4), and IRF9

(19) Comparative Transcriptomic Analysis of Rhinovirus and Influenza Virus InfectionFrontiers in MicrobiologyJuly 21, 2020Thrimendra Kaushika Dissanayake et al.independent experiment. ELISA was done using Human DuoSet ELISA kits for IFN-λ1/λ2/λ3 (Catalog number DY7246, DY1587, DY5259) and CXCL10 (Catalog number DY266) (R&D Systems). Error bars represent SEM. Statistical

(20) Human Papillomavirus E7 Oncoprotein Subverts Host Innate Immunity via SUV39H1-Mediated Epigenetic Silencing of Immune Sensor GenesJournal of virologyJanuary 31, 2020Lo Cigno I, Calati F, Borgogna C, Zevini A, Albertini S, Martuscelli L, De Andrea M, Hiscott J, Landolfo S, Gariglio M.enzyme-linked immunosorbent assay (ELISA) kits for IFN-␤ (DY814-05; DuoSet ELISA human IFN-␤; R&D Systems) and IFN-␭1 (DY7246; DuoSet ELISA human IL-29/IFN-␭1; R&D Systems) according to the manufacturer’s instructions. All absorbance

Be the First to Write a Review!

IL-29/IFN-lambda 1 ELISA

Human IL-29/IFN-lambda 1 DuoSet ELISA

Human IL-29/IFN-lambda 1 DuoSet ELISA from R&D Systems, a Bio-Techne Brand

R&D Systems, a Bio-Techne Brand

Citations (29)

Reviews

Human IL-29/IFN-lambda 1 DuoSet ELISA from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map