Fig 2: TNF-a stimulation induces Nurr1 phosphorylation by NIK, which triggers its association with CoREST repressor complex for HIV silencing.A, schematic presentation of TNF-a induced Nurr1 phosphorylation and its association with CoREST for HIV silencing. B Knock down (KD) of NIK in HC69 cells with NIK specific shRNAs (Santa Cruz Biotech, Cat# sc-36079V) and control shRNA respectively. Left: The relative levels of NIK mRNA from HC69 cells expressing control shRNA (grey bars) and NIK shRNA (green bars) was measured by qRT-PCR using the primers 5’ TGCGGAAAGTGGGAGATCCTGAAT 3’ (forward) and 5’ TGTACTGTTTGGACCCAGCGATGA 3’ (reverse). Expression levels were then normalized to the ß-actin gene. Right: Western blot analysis of NIK protein levels using a rabbit monoclonal antibody (abcam Cat # ab203568). C. Co-immunoprecipitation (co-IP) of CoREST, pSer-Nurr1 and Nurr1. Total protein extracts from HC69 cells expressing control shRNA or NIK shRNAs that were untreated, induced with a high dose (400 pg/ml) of TNF-a for different time points, or stimulated for 24 hr followed by a 24 hr chase. co-IP experiments were performed using a mouse monoclonal anti-Nurr1 antibody (Santa Cruz Biotech) or control mouse IgG. Right: The co-IP products were analyzed by Western blot to detect the pulled down Nurr1 protein (using the same anti-Nurr1 antibody), serine-phosphorylated Nurr1 by using a mouse monoclonal anti-phospho-serine antibody from Millipore-Sigma (Cat# P5747-25), and CoREST by using a rabbit polyclonal anti-CoREST antibody (EMD Millipore, Cat# 07–579). Left: Ratios of pSer-Nurr1/Nurr1 and CoRES/Nurr1 in Co-IP samples measured by densitometry of the Western blots. D, GFP expression in HC69 cells expressing either control shRNA (grey bars) and NIK shRNAs (green bars). Cells were untreated, induced with a high dose (400 pg/ml) of TNF-a for 24 hr, or continuously cultured in the absence of TNF-a for 48 hr (chase), in presence or absence of 1 µM 6-MP. The p-values of pair-sample, Student’s t-tests for differences in the numbers of GFP+ cells were calculated from three technical replicates. E, Western blot detection of Nef protein in cells treated as described in D. ß-Tubulin was used as loading control.

Fig 3: Neomorphic KBTBD4 mutations enable this E3 ubiquitin ligase to recruit, ubiquitylate and degrade CoREST favouring proliferation of neuronal progenitors and tumorigenesis.During normal development, CoREST complexes containing LSD1, HDAC1 or 2, and CoRESTs (also known as RCORs) silence chromatin by deacetylating and demethylating histone H3 at position Lys4 (K4). In medulloblastoma, mutations allow KBTBD4 to destabilise CoREST complexes thereby preventing chromatin repression leading to the increased transcription of CoREST targets and stemness genes. The activation of stemness genes is a potential driver of medulloblastoma tumorigenesis.

Fig 4: Expression of KBTBD4 mutants in medulloblastoma cells promotes CoREST ubiquitylation and modifies epigenetic marks.A D283Med cells expressing Flag-KBTBD4WT, Flag-KBTBD4R313PRR or Flag-KBTBD4P311PP after doxycycline induction (1 µg/mL for 40 h) were treated with 100 nM MLN4924 for 4 h as indicated (+). After lysis, extracts were immunoprecipitated with Flag-resin and immunoblotted as indicated. B D283Med cells expressing Flag-KBTBD4WT, Flag-KBTBD4R313PRR or Flag-KBTBD4P311PP were treated with doxycycline (1 µg/mL) for 16 h and lysed. Endogenous ubiquitylated proteins were isolated using GST fused ubiquitin binding domain UBAUbq and separated by SDS-PAGE. Isolated proteins were detected by immunoblot as indicated. All samples were treated with MG132 for 6 h. C D283Med cells containing Flag-KBTBD4WT, Flag-KBTBD4R313PRR or Flag-KBTBD4P311PP were treated with doxycycline (1 µg/mL) for the indicated time (h = hours). Samples were separated by SDS-page and immunoblotted as indicated. D, E Flow cytometry analysis. D (Top three panels) Representative images showing the gating procedure where Negative and Positive gates were determined using 5 controls: Compensation beads (green), unstained cells (orange), cells stained only with secondary antibody (not shown), cells treated with LSD1 inhibitor followed by incubation with either isotype (Blue) or H3K4me2 (red) primary antibodies and secondary antibody. The remaining panels are representative images showing the results related to flow cytometry analysis of H3K4me1 and H3K4me2 in D283Med cells expressing Flag-KBTBD4WT, Flag-KBTBD4R313PRR or Flag-KBTBD4P311PP after doxycycline induction (1 µg/mL for 4 days). E Bar charts showing the quantification of the analysis in D, plotted as percentage increase of the Mean Fluorescence Intensity (MFI) of positive cells where controls (- doxy) were set as 100% (dashed line). Data are presented as mean ±standard deviation (SD), with at least three independent experiments. P values (*P < 0.05 and **P < 0.005) were calculated by paired and two-tailed t-test.

Fig 5: ChIP-Seq analysis of the recruitment of Nurr1 and histone modifiers to the HIV provirus.Histograms show numbers of sequence reads on the Y axis along the length of the reporter HIV-1 pro-viral genome on the X axis. A, Aligned reporter genome. B, Nurr1 (Santa Cruz Biotech, Cat #sc-81345). C, CoREST (Cell Signaling, Cat #14567. D, EZH2 (Cell Signaling, Cat #5246S). E, G9a (Cell Signaling, Cat #3306S). F, HDAC1 (Santa Cruz Biotechnology, Cat #sc-7872). G, IgG control. For each antibody, chromatin was prepared from HC69 cells that were untreated, induced with TNF-a (400 pg/ml) for 4 hr and 24 hr respectively, or used in a chase experiment by continuously culturing HC69 cells in the absence of TNF-a for 24 hr after stimulating the cells with TNF-a (400 pg/ml) for 24 hr. Construction of ChIP-Seq DNA libraries with the ChIP products, enrichment for HIV-1 specific sequences, and data analysis following Ion Torrent sequencing were described in Materials & Methods. The sequence reads on the Y axis were set at the same scales for different time points of ChIP-seq using the same antibody but varied for ChIP-seq with different antibodies, which were from 0 to 2800 reads for ChIP-Seq/Nurr1, 0 to 200 reads for ChIP-Seq/EZH2, 0 to 400 reads for ChIP-Seq/CoREST, 0 to 300 reads for ChIP-seq/G9a, 0 to 1300 reads for ChIP-Seq/HDAC1, and 0 to 200 reads for ChIP-Seq/IgG, respectively.