c-Fgr (D-6) Antibody sc-74542 from Santa Cruz Biotechnology, Inc.

Product Specs
Itemc-Fgr (D-6) Antibody
CompanySanta Cruz Biotechnology, Inc.
Price $316.00Supplier Page View Company Product Page
Catalog Numbersc-74542
Antibody TypePrimary Antibodies
CloneD-6
Quantity200 µg/ml
ApplicationsWB, IP, IF, ELISA
Reactivitymouse
Conjugate/TagUnconjugated
ClonalityMonoclonal
FormatPurified
Hostmouse
Targetc-Fgr
IsotypeIgG2b
NCBI Full Gene NameFGR proto-oncogene, Src family tyrosine kinase
NCBI Gene AliasesAli18, Mhdaali18

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Inhibition of tyrosine kinase Fgr prevents radiation-induced pulmonary fibrosis (RIPF)Cell death discoveryJuly 17, 2023Mukherjee A, Epperly MW, Fisher R, Hou W, Shields D, Saiful Huq M, Pifer PM, Mulherkar R, Wilhite TJ, Wang H, et al.of Pittsburgh’s Internal Review Board (IRB). Antibodies for immunohistochemistry Antibody to Fgr (sc-74542 and for humans, sc-166079), and F4/80 (sc-377009) for staining mouse and human lungs were purchased

(2) Ionizing irradiation-induced Fgr in senescent cells mediates fibrosisCell death discoveryNovember 12, 2021Mukherjee A, Epperly MW, Shields D, Hou W, Fisher R, Hamade D, Wang H, Saiful Huq M, Bao R, Tabib T, et al.NM_010208.2-853s1c1 Sequence: CCGGCGGCACTACATGGAAGTGAATCTCGAGATTCACTTCCATGTAGTG CCGTTTTT), Rabbit anti-Fgr (# sc-74542) antibody was purchased from Santa Cruz Biotechnology, Inc and anti-phospho-Fgr antibody was purchased

(3) The receptor-type protein tyrosine phosphatase CD45 promotes onset and severity of IL-1β-mediated autoinflammatory osteomyelitisThe Journal of biological chemistryOctober 1, 2021Kralova J, Pavliuchenko N, Fabisik M, Ilievova K, Spoutil F, Prochazka J, Pokorna J, Sedlacek R, Brdicka T.

(4) Fgr contributes to hemorrhage-induced thalamic pain by activating NF-κB/ERK1/2 pathwaysJCI insightOctober 15, 2020Huang T, Fu G, Gao J, Zhang Y, Cai W, Wu S, Jia S, Xia S, Bachmann T, Bekker A, et al.incubated overnight at 4°C with mouse anti-Fgr (1:50; Santa Cruz Biotechnology Inc.; catalog number: sc-74542) alone; with a mixture of mouse anti-Fgr (1:50) and rabbit anti-NeuN (1:500; Invitrogen, Thermo Fisher Scientific

(5) Omega-3 fatty acid epoxides are autocrine mediators that control the magnitude of IgE-mediated mast cell activationNature medicineNovember 1, 2017Shimanaka Y, Kono N, Taketomi Y, Arita M, Okayama Y, Tanaka Y, Nishito Y, Mochizuki T, Kusuhara H, Adibekian A, et al.

Be the First to Write a Review!

c-Fgr (D-6) Antibody

c-Fgr (D-6) Antibody from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (5)

Reviews

c-Fgr (D-6) Antibody from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map